ZFIN ID: ZDB-MRPHLNO-080801-5
Morpholino Name: MO1-atr
Target: atr (1)
Sequence:
5' - TGACATTTCTAGTCCTTGCTCCATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-atr No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-atr
Expressed Gene Anatomy Figures
atr Fig. S5 with image from Sidi et al., 2008
bbc3 Fig. 3 with image from Stiff et al., 2016
cdkn1a Fig. 3 with image from Stiff et al., 2016
gli1 Fig. 3 with image from Stiff et al., 2016
spaw Fig. 5 with image from Stiff et al., 2016
PHENOTYPE
Phenotype resulting from MO1-atr
Phenotype Figures
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal Fig. 5 with image from Stiff et al., 2016
determination of left/right asymmetry in lateral mesoderm process quality, abnormal Fig. 5 with image from Stiff et al., 2016
determination of pancreatic left/right asymmetry decreased occurrence, abnormal Fig. 5 with image from Stiff et al., 2016
eye decreased size, abnormal Fig. 4 with image from Stiff et al., 2016
head decreased size, abnormal Fig. 4 with image from Stiff et al., 2016
heart looping decreased occurrence, abnormal Fig. 5 with image from Stiff et al., 2016
heart looping process quality, abnormal Fig. 5 with image from Stiff et al., 2016
Kupffer's vesicle decreased size, abnormal Fig. 3 with image from Stiff et al., 2016
Kupffer's vesicle motile cilium decreased length, abnormal Fig. 3 with image from Stiff et al., 2016
lateral plate mesoderm spaw expression mislocalised, abnormal Fig. 5 with image from Stiff et al., 2016
lateral plate mesoderm right side spaw expression mislocalised, abnormal Fig. 5 with image from Stiff et al., 2016
pancreas mislocalised, abnormal Fig. 5 with image from Stiff et al., 2016
pericardium edematous, abnormal Fig. S2 with image from Stiff et al., 2016
whole organism cdkn1a expression decreased amount, abnormal Fig. 3 with image from Stiff et al., 2016
whole organism gli1 expression decreased amount, abnormal Fig. 3 with image from Stiff et al., 2016
whole organism bbc3 expression decreased amount, abnormal Fig. 3 with image from Stiff et al., 2016
whole organism anterior-posterior axis increased curvature, abnormal Fig. 4 with imageFig. S2 with image from Stiff et al., 2016

Phenotype of all Fish created by or utilizing MO1-atr
Phenotype Fish Conditions Figures
heart looping process quality, abnormal WT + MO1-atr standard conditions Fig. 5 with image from Stiff et al., 2016
determination of left/right asymmetry in lateral mesoderm process quality, abnormal WT + MO1-atr standard conditions Fig. 5 with image from Stiff et al., 2016
lateral plate mesoderm right side spaw expression mislocalised, abnormal WT + MO1-atr standard conditions Fig. 5 with image from Stiff et al., 2016
eye decreased size, abnormal WT + MO1-atr standard conditions Fig. 4 with image from Stiff et al., 2016
whole organism gli1 expression decreased amount, abnormal WT + MO1-atr standard conditions Fig. 3 with image from Stiff et al., 2016
pericardium edematous, abnormal WT + MO1-atr standard conditions Fig. S2 with image from Stiff et al., 2016
determination of pancreatic left/right asymmetry decreased occurrence, abnormal WT + MO1-atr standard conditions Fig. 5 with image from Stiff et al., 2016
lateral plate mesoderm spaw expression mislocalised, abnormal WT + MO1-atr standard conditions Fig. 5 with image from Stiff et al., 2016
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO1-atr standard conditions Fig. 3 with image from Stiff et al., 2016
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-atr standard conditions Fig. 4 with imageFig. S2 with image from Stiff et al., 2016
whole organism bbc3 expression decreased amount, abnormal WT + MO1-atr standard conditions Fig. 3 with image from Stiff et al., 2016
head decreased size, abnormal WT + MO1-atr standard conditions Fig. 4 with image from Stiff et al., 2016
pancreas mislocalised, abnormal WT + MO1-atr standard conditions Fig. 5 with image from Stiff et al., 2016
whole organism cdkn1a expression decreased amount, abnormal WT + MO1-atr standard conditions Fig. 3 with image from Stiff et al., 2016
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal WT + MO1-atr standard conditions Fig. 5 with image from Stiff et al., 2016
Kupffer's vesicle decreased size, abnormal WT + MO1-atr standard conditions Fig. 3 with image from Stiff et al., 2016
heart looping decreased occurrence, abnormal WT + MO1-atr standard conditions Fig. 5 with image from Stiff et al., 2016
whole organism apoptotic, abnormal tp53zdf1/zdf1 + MO1-atr radiation Fig. 1 with image from Sidi et al., 2008
intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator disrupted, abnormal tp53zdf1/zdf1 + MO1-atr radiation Fig. 1 with image from Sidi et al., 2008
whole organism decreased sensitivity to irradiation, abnormal tp53zdf1/zdf1 + MO1-atr radiation Fig. 1 with image from Sidi et al., 2008
spinal cord apoptotic, abnormal tp53zdf1/zdf1 + MO1-atr + MO2-chek1 radiation Fig. 4 with image from Sidi et al., 2008
OTHER MO1-atr MORPHOLINO PAGESNo links to external sites
CITATIONS (4)