Morpholino

MO2-tjp3

ID
ZDB-MRPHLNO-080623-2
Name
MO2-tjp3
Previous Names
None
Target
Sequence
5' - ACCTCGCCACTTACTTTCGATAACG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tjp3
Phenotype
Phenotype resulting from MO2-tjp3
Phenotype of all Fish created by or utilizing MO2-tjp3
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal AB + MO2-tjp3 standard conditions Fig. 2 with image from Kiener et al., 2008
whole organism decreased life span, abnormal AB + MO2-tjp3 chemical treatment: sodium chloride Fig. 9 with image from Kiener et al., 2008
post-vent region structure, abnormal AB + MO2-tjp3 standard conditions Fig. 4 with image from Kiener et al., 2008
post-vent region increased curvature, abnormal AB + MO2-tjp3 standard conditions Fig. 2 with imageFig. 10 with image from Kiener et al., 2008
EVL increased permeability, abnormal AB + MO2-tjp3 chemical treatment: biotin Fig. 8 with image from Kiener et al., 2008
EVL lacks parts or has fewer parts of type EVL bicellular tight junction, abnormal AB + MO2-tjp3 standard conditions Fig. 6 with image from Kiener et al., 2008
post-vent region decreased length, abnormal AB + MO2-tjp3 standard conditions Fig. 2 with image from Kiener et al., 2008
blood circulation arrested, abnormal AB + MO2-tjp3 standard conditions Fig. 2 with imageFig. 4 with imageFig. 10 with image from Kiener et al., 2008
response to osmotic stress disrupted, abnormal AB + MO2-tjp3 chemical treatment: sodium chloride Fig. 9 with image from Kiener et al., 2008
EVL bicellular tight junction decreased amount, abnormal AB + MO2-tjp3 standard conditions Fig. 6 with image from Kiener et al., 2008
whole organism lethal (sensu genetics), abnormal AB + MO2-tjp3 chemical treatment: sucrose Fig. 10 with image from Kiener et al., 2008
response to osmotic stress disrupted, abnormal AB + MO2-tjp3 chemical treatment: salt Fig. 9 with image from Kiener et al., 2008
caudal fin decreased size, abnormal AB + MO2-tjp3 standard conditions Fig. 2 with imageFig. 4 with imageFig. 10 with image from Kiener et al., 2008
pericardium edematous, abnormal AB + MO2-tjp3 standard conditions Fig. 2 with imageFig. 4 with imageFig. 10 with image from Kiener et al., 2008
whole organism decreased life span, abnormal AB + MO2-tjp3 chemical treatment: magnesium sulfate Fig. 9 with image from Kiener et al., 2008
pericardium edematous, abnormal AB + MO2-tjp3 chemical treatment: sucrose Fig. 10 with image from Kiener et al., 2008
whole organism decreased life span, abnormal AB + MO2-tjp3 chemical treatment: calcium dichloride Fig. 9 with image from Kiener et al., 2008
whole organism decreased life span, abnormal AB + MO2-tjp3 chemical treatment: salt Fig. 9 with image from Kiener et al., 2008
response to osmotic stress disrupted, abnormal AB + MO2-tjp3 chemical treatment: calcium dichloride Fig. 9 with image from Kiener et al., 2008
blood island increased size, abnormal AB + MO2-tjp3 standard conditions Fig. 2 with image from Kiener et al., 2008
response to osmotic stress disrupted, abnormal AB + MO2-tjp3 chemical treatment: magnesium sulfate Fig. 9 with image from Kiener et al., 2008
Citations