ZFIN ID: ZDB-MRPHLNO-080623-1
Morpholino Name: MO1-tjp3
Target: tjp3 (1)
Sequence:
5' - GCTCCCATATCGTCATCTCCTCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-tjp3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-tjp3 No data available
PHENOTYPE
Phenotype resulting from MO1-tjp3
Phenotype of all Fish created by or utilizing MO1-tjp3
Genome Resources:
CITATIONS (1)