ZFIN ID: ZDB-MRPHLNO-080505-1
Morpholino Name: MO1-ppargc1a
Target: ppargc1a (1)
Previous Name: MO1-ppargc1al

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCTGATTACACCTGTCCCACGCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ppargc1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ppargc1a No data available
PHENOTYPE
Phenotype resulting from MO1-ppargc1a
No data available

Phenotype of all Fish created by or utilizing MO1-ppargc1a
Phenotype Fish Conditions Figures
myotome skeletal muscle cell morphology, abnormal WT + MO1-ppargc1a + MO2-ppargc1a standard conditions Fig. 9 from Hanai et al., 2007
muscle morphology, abnormal WT + MO1-ppargc1a + MO2-ppargc1a standard conditions Fig. 9 from Hanai et al., 2007
skeletal muscle tissue development disrupted, abnormal WT + MO1-ppargc1a + MO2-ppargc1a standard conditions Fig. 9 from Hanai et al., 2007
OTHER MO1-ppargc1a MORPHOLINO PAGESNo links to external sites
CITATIONS (3)