Community Action Needed: Please respond to the NIH RFI
Morpholino

MO1-ppargc1a

ID
ZDB-MRPHLNO-080505-1
Name
MO1-ppargc1a
Previous Names
  • MO1-ppargc1al
Target
Sequence
5' - CCTGATTACACCTGTCCCACGCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ppargc1a
Phenotype
Phenotype resulting from MO1-ppargc1a
Phenotype Fish Figures
determination of heart left/right asymmetry decreased process quality, abnormal TU + MO1-ppargc1a Fig. 1 with image from Chambers et al., 2020
heart mislocalised, abnormal TU + MO1-ppargc1a Fig. 1 with image from Chambers et al., 2020
Kupffer's vesicle has fewer parts of type Kupffer's vesicle cilium, abnormal TU + MO1-ppargc1a Fig. 1 with image from Chambers et al., 2020
Kupffer's vesicle cilium decreased length, abnormal TU + MO1-ppargc1a Fig. 1 with image from Chambers et al., 2020
Kupffer's vesicle cilium assembly decreased process quality, abnormal TU + MO1-ppargc1a Fig. 1 with image from Chambers et al., 2020
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-ppargc1a Fig. 2 with imageFig. 3 with image from Chambers et al., 2018
pronephric proximal straight tubule trpm7 expression increased distribution, abnormal TU + MO1-ppargc1a Fig. 2 with imageFig. 3 with image from Chambers et al., 2018
pronephros has extra parts of type pronephros single ciliated epithelial cell, abnormal TU + MO1-ppargc1a Fig. 2 with image from Chambers et al., 2020
pronephros has fewer parts of type pronephros multi-ciliated epithelial cell, abnormal TU + MO1-ppargc1a Fig. 2 with imageFig. 3 with imageFig. 4 with image from Chambers et al., 2020
pronephros cilium ab1-tuba labeling decreased amount, abnormal TU + MO1-ppargc1a Fig. 2 with imageFig. 3 with image from Chambers et al., 2020
pronephros cilium decreased length, abnormal TU + MO1-ppargc1a Fig. 2 with imageFig. 3 with image from Chambers et al., 2020
pronephros cilium assembly decreased process quality, abnormal TU + MO1-ppargc1a Fig. 2 with imageFig. 3 with image from Chambers et al., 2020
pronephros distal region has fewer parts of type ciliated epithelial cell ciliary basal body, abnormal TU + MO1-ppargc1a Fig. 2 with imageFig. 3 with image from Chambers et al., 2020
pronephros proximal region has fewer parts of type ciliated epithelial cell ciliary basal body, abnormal TU + MO1-ppargc1a Fig. 2 with imageFig. 3 with image from Chambers et al., 2020
trunk curved ventral, abnormal TU + MO1-ppargc1a Fig. 4 with image from Chambers et al., 2020
Phenotype of all Fish created by or utilizing MO1-ppargc1a
Phenotype Fish Conditions Figures
pronephros has number of pronephros multi-ciliated epithelial cell, ameliorated TU + MO1-ppargc1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 3 with image from Chambers et al., 2020
heart mislocalised, abnormal TU + MO1-ppargc1a standard conditions Fig. 1 with image from Chambers et al., 2020
pronephros distal region has number of ciliated epithelial cell ciliary basal body, ameliorated TU + MO1-ppargc1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 3 with image from Chambers et al., 2020
determination of heart left/right asymmetry decreased process quality, abnormal TU + MO1-ppargc1a standard conditions Fig. 1 with image from Chambers et al., 2020
pronephros cilium assembly process quality, ameliorated TU + MO1-ppargc1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 3 with image from Chambers et al., 2020
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-ppargc1a control Fig. 2 with imageFig. 3 with image from Chambers et al., 2018
pronephros has extra parts of type pronephros single ciliated epithelial cell, abnormal TU + MO1-ppargc1a standard conditions Fig. 2 with image from Chambers et al., 2020
Kupffer's vesicle cilium assembly decreased process quality, abnormal TU + MO1-ppargc1a standard conditions Fig. 1 with image from Chambers et al., 2020
trunk curved ventral, abnormal TU + MO1-ppargc1a standard conditions Fig. 4 with image from Chambers et al., 2020
pronephros cilium decreased length, abnormal TU + MO1-ppargc1a standard conditions Fig. 2 with imageFig. 3 with image from Chambers et al., 2020
pronephros distal region has fewer parts of type ciliated epithelial cell ciliary basal body, abnormal TU + MO1-ppargc1a standard conditions Fig. 2 with imageFig. 3 with image from Chambers et al., 2020
Kupffer's vesicle has fewer parts of type Kupffer's vesicle cilium, abnormal TU + MO1-ppargc1a standard conditions Fig. 1 with image from Chambers et al., 2020
pronephric proximal straight tubule trpm7 expression increased distribution, abnormal TU + MO1-ppargc1a control Fig. 2 with imageFig. 3 with image from Chambers et al., 2018
pronephros cilium ab1-tuba labeling amount, ameliorated TU + MO1-ppargc1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 3 with image from Chambers et al., 2020
pronephros cilium length, ameliorated TU + MO1-ppargc1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 3 with image from Chambers et al., 2020
pronephros cilium assembly decreased process quality, abnormal TU + MO1-ppargc1a standard conditions Fig. 2 with imageFig. 3 with image from Chambers et al., 2020
Kupffer's vesicle cilium decreased length, abnormal TU + MO1-ppargc1a standard conditions Fig. 1 with image from Chambers et al., 2020
pronephros cilium ab1-tuba labeling decreased amount, abnormal TU + MO1-ppargc1a standard conditions Fig. 2 with imageFig. 3 with image from Chambers et al., 2020
pronephros proximal region has number of ciliated epithelial cell ciliary basal body, ameliorated TU + MO1-ppargc1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 3 with image from Chambers et al., 2020
pronephros proximal region has fewer parts of type ciliated epithelial cell ciliary basal body, abnormal TU + MO1-ppargc1a standard conditions Fig. 2 with imageFig. 3 with image from Chambers et al., 2020
pronephros has fewer parts of type pronephros multi-ciliated epithelial cell, abnormal TU + MO1-ppargc1a standard conditions Fig. 2 with imageFig. 3 with imageFig. 4 with image from Chambers et al., 2020
muscle morphology, abnormal WT + MO1-ppargc1a + MO2-ppargc1a standard conditions Fig. 9 from Hanai et al., 2007
skeletal muscle tissue development disrupted, abnormal WT + MO1-ppargc1a + MO2-ppargc1a standard conditions Fig. 9 from Hanai et al., 2007
myotome skeletal muscle cell morphology, abnormal WT + MO1-ppargc1a + MO2-ppargc1a standard conditions Fig. 9 from Hanai et al., 2007
trunk curvature, ameliorated TU + MO1-ppargc1a + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Chambers et al., 2020
trunk curved ventral, exacerbated TU + MO1-ppargc1a + MO1-ptgs1 standard conditions Fig. 4 with image from Chambers et al., 2020
pronephros cilium assembly process quality, ameliorated TU + MO1-ppargc1a + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Chambers et al., 2020
pronephros has fewer parts of type ciliated epithelial cell ciliary basal body, exacerbated TU + MO1-ppargc1a + MO1-ptgs1 standard conditions Fig. 4 with image from Chambers et al., 2020
pronephros cilium assembly decreased process quality, exacerbated TU + MO1-ppargc1a + MO1-ptgs1 standard conditions Fig. 4 with image from Chambers et al., 2020
pronephros cilium decreased length, exacerbated TU + MO1-ppargc1a + MO1-ptgs1 standard conditions Fig. 4 with image from Chambers et al., 2020
pronephros cilium length, ameliorated TU + MO1-ppargc1a + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Chambers et al., 2020
pronephros has number of pronephros multi-ciliated epithelial cell, ameliorated TU + MO1-ppargc1a + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Chambers et al., 2020
Citations