header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080325-4
Morpholino Name: MO2-myd88
Target: myd88 (1)
Sequence:
5' - GTTAAACACTGACCCTGTGGATCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: splice blocker (exon2-intron2)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-myd88 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-myd88
Expressed Gene Anatomy Figures
myd88 Fig. 8 from Fehr et al., 2016
Fig. S4 from Cambier et al., 2014
PHENOTYPE
Phenotype resulting from MO2-myd88
Phenotype of all Fish created by or utilizing MO2-myd88
Phenotype Fish Conditions Figures
fourth ventricle monocyte decreased amount, abnormal AB + MO2-myd88 bacterial treatment by injection: Pseudomonas aeruginosa Fig. 1 with image from Cambier et al., 2017
fourth ventricle monocyte decreased amount, abnormal AB + MO2-myd88 bacterial treatment by injection: Staphylococcus aureus Fig. 1 with image from Cambier et al., 2017
fourth ventricle monocyte chemotaxis decreased occurrence, abnormal AB + MO2-myd88 bacterial treatment by injection: Pseudomonas aeruginosa Fig. 1 with image from Cambier et al., 2017
fourth ventricle monocyte chemotaxis decreased occurrence, abnormal AB + MO2-myd88 bacterial treatment by injection: Staphylococcus aureus Fig. 1 with image from Cambier et al., 2017
fourth ventricle neutrophil decreased amount, abnormal AB + MO2-myd88 bacterial treatment by injection: Staphylococcus aureus Fig. 1 with image from Cambier et al., 2017
fourth ventricle neutrophil decreased amount, abnormal AB + MO2-myd88 bacterial treatment by injection: Pseudomonas aeruginosa Fig. 1 with image from Cambier et al., 2017
whole organism neutrophil decreased amount, abnormal WT + MO2-myd88 bacterial treatment by injection: Waddlia chondrophila WSU 86-1044 Fig. 8 from Fehr et al., 2016
whole organism myd88 expression decreased amount, abnormal WT + MO2-myd88 control Fig. 8 from Fehr et al., 2016
activation of innate immune response decreased process quality, abnormal WT + MO2-myd88 standard conditions Fig. 6 with image from van der Vaart et al., 2013
alkaline phosphatase activity decreased occurrence, abnormal WT + MO2-myd88 standard conditions Fig. 1 from Bates et al., 2007
whole organism decreased life span, exacerbated WT + MO2-myd88 bacterial treatment by injection: Waddlia chondrophila WSU 86-1044 Fig. 8 from Fehr et al., 2016
macrophage chemotaxis decreased occurrence, abnormal w201Tg + MO2-myd88(AB) bacterial treatment by injection: Mycobacterium leprae Fig. 1 with image from Madigan et al., 2017
macrophage chemotaxis decreased occurrence, abnormal w201Tg + MO2-myd88(AB) bacterial treatment by injection: Mycobacterium marinum Fig. 1 with image from Madigan et al., 2017
cell autophagosome decreased amount, abnormal zf155Tg + MO2-myd88 bacterial treatment: Mycobacterium marinum Fig. 6 with image from van der Vaart et al., 2014
neutrophil decreased amount, abnormal hkz04tTg; nz50Tg + MO2-myd88 + MO4-myd88 amputation: caudal fin Fig. 2 from Yan et al., 2014
neutrophil chemotaxis decreased process quality, abnormal hkz04tTg; nz50Tg + MO2-myd88 + MO4-myd88 amputation: caudal fin Fig. 2Fig. 4 from Yan et al., 2014
epithelial cell proliferation increased occurrence, abnormal axin1tm213/tm213 + MO2-myd88 standard conditions Fig. 4 with image from Cheesman et al., 2011
intestinal bulb epithelium cellular quality, abnormal axin1tm213/tm213 + MO2-myd88 standard conditions Fig. 4 with image from Cheesman et al., 2011
neutrophil decreased amount, abnormal hkz04tTg; nz50Tg + MO2-myd88 + MO3-il1b + MO4-myd88 amputation: caudal fin Fig. 2 from Yan et al., 2014
neutrophil chemotaxis decreased process quality, abnormal hkz04tTg; nz50Tg + MO2-myd88 + MO3-il1b + MO4-myd88 amputation: caudal fin Fig. 2 from Yan et al., 2014
OTHER MO2-myd88 MORPHOLINO PAGES No links to external sites
CITATIONS (13)