Morpholino

MO2-myd88

ID
ZDB-MRPHLNO-080325-4
Name
MO2-myd88
Previous Names
None
Target
Sequence
5' - GTTAAACACTGACCCTGTGGATCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice blocker (exon2-intron2)
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-myd88
Expressed Gene Anatomy Figures
myd88 Fig. 8 from Fehr et al., 2016
Fig. S4 from Cambier et al., 2014
Phenotype
Phenotype resulting from MO2-myd88
Phenotype Fish Figures
activation of innate immune response decreased process quality, abnormal WT + MO2-myd88 Fig. 6 with image from van der Vaart et al., 2013
alkaline phosphatase activity decreased occurrence, abnormal WT + MO2-myd88 Fig. 1 from Bates et al., 2007
intestinal bulb peptide hormone secreting cell decreased amount, abnormal WT + MO2-myd88 Fig. 4 from Troll et al., 2018
posterior intestine goblet cell decreased amount, abnormal WT + MO2-myd88 Fig. 3,  Fig. 4 from Troll et al., 2018
whole organism myd88 expression decreased amount, abnormal WT + MO2-myd88 Fig. 8 from Fehr et al., 2016
Phenotype of all Fish created by or utilizing MO2-myd88
Phenotype Fish Conditions Figures
fourth ventricle monocyte decreased amount, abnormal AB + MO2-myd88 bacterial treatment by injection: Pseudomonas aeruginosa Fig. 1 with image from Cambier et al., 2017
fourth ventricle monocyte decreased amount, abnormal AB + MO2-myd88 bacterial treatment by injection: Staphylococcus aureus Fig. 1 with image from Cambier et al., 2017
fourth ventricle monocyte chemotaxis decreased occurrence, abnormal AB + MO2-myd88 bacterial treatment by injection: Staphylococcus aureus Fig. 1 with image from Cambier et al., 2017
fourth ventricle neutrophil decreased amount, abnormal AB + MO2-myd88 bacterial treatment by injection: Staphylococcus aureus Fig. 1 with image from Cambier et al., 2017
fourth ventricle neutrophil decreased amount, abnormal AB + MO2-myd88 bacterial treatment by injection: Pseudomonas aeruginosa Fig. 1 with image from Cambier et al., 2017
fourth ventricle monocyte chemotaxis decreased occurrence, abnormal AB + MO2-myd88 bacterial treatment by injection: Pseudomonas aeruginosa Fig. 1 with image from Cambier et al., 2017
whole organism neutrophil decreased amount, abnormal WT + MO2-myd88 bacterial treatment by injection: Waddlia chondrophila WSU 86-1044 Fig. 8 from Fehr et al., 2016
posterior intestine goblet cell decreased amount, abnormal WT + MO2-myd88 control Fig. 3,  Fig. 4 from Troll et al., 2018
activation of innate immune response decreased process quality, abnormal WT + MO2-myd88 standard conditions Fig. 6 with image from van der Vaart et al., 2013
alkaline phosphatase activity decreased occurrence, abnormal WT + MO2-myd88 standard conditions Fig. 1 from Bates et al., 2007
intestinal bulb peptide hormone secreting cell decreased amount, abnormal WT + MO2-myd88 control Fig. 4 from Troll et al., 2018
posterior intestine goblet cell decreased amount, abnormal WT + MO2-myd88 germ free Fig. 3 from Troll et al., 2018
whole organism decreased life span, exacerbated WT + MO2-myd88 bacterial treatment by injection: Waddlia chondrophila WSU 86-1044 Fig. 8 from Fehr et al., 2016
whole organism myd88 expression decreased amount, abnormal WT + MO2-myd88 control Fig. 8 from Fehr et al., 2016
macrophage chemotaxis decreased occurrence, abnormal w201Tg + MO2-myd88 (AB) bacterial treatment by injection: Mycobacterium leprae Fig. 1 with image from Madigan et al., 2017
macrophage chemotaxis decreased occurrence, abnormal w201Tg + MO2-myd88 (AB) bacterial treatment by injection: Mycobacterium marinum Fig. 1 with image from Madigan et al., 2017
cell autophagosome decreased amount, abnormal zf155Tg + MO2-myd88 bacterial treatment: Mycobacterium marinum Fig. 6 with image from van der Vaart et al., 2014
neutrophil decreased amount, abnormal hkz04tTg; nz50Tg + MO2-myd88 + MO4-myd88 amputation: caudal fin Fig. 2 from Yan et al., 2014
neutrophil chemotaxis decreased process quality, abnormal hkz04tTg; nz50Tg + MO2-myd88 + MO4-myd88 amputation: caudal fin Fig. 2,  Fig. 4 from Yan et al., 2014
epithelial cell proliferation increased occurrence, abnormal axin1tm213/tm213 + MO2-myd88 standard conditions Fig. 4 with image from Cheesman et al., 2011
intestinal bulb epithelium cellular quality, abnormal axin1tm213/tm213 + MO2-myd88 standard conditions Fig. 4 with image from Cheesman et al., 2011
posterior intestine goblet cell increased amount, abnormal dldtr233/tr233 + MO2-myd88 control Fig. 4 from Troll et al., 2018
intestinal bulb peptide hormone secreting cell amount, ameliorated b1390Tg + MO2-myd88 control Fig. 4 from Troll et al., 2018
neutrophil decreased amount, abnormal hkz04tTg; nz50Tg + MO2-myd88 + MO3-il1b + MO4-myd88 amputation: caudal fin Fig. 2 from Yan et al., 2014
neutrophil chemotaxis decreased process quality, abnormal hkz04tTg; nz50Tg + MO2-myd88 + MO3-il1b + MO4-myd88 amputation: caudal fin Fig. 2 from Yan et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.