ZFIN ID: ZDB-MRPHLNO-080226-1
Morpholino Name: MO4-tfap2a
Target: tfap2a (1)
Previous Name: ap2a E2I2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGCTTTTCTTCTTACCTGAACATCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a splice blocking morpholino designed against the exon 2 - intron 2 splice site.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-tfap2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-tfap2a
Expressed Gene Anatomy Figures
fgf3 Fig. 6 with image from Kantarci et al., 2015
fgf8a Fig. 6 with image from Kantarci et al., 2015
fgf10a Fig. 6 with image from Kantarci et al., 2015
fscn1a Fig. 1 with image from Boer et al., 2015
pax5 Fig. 5 with image from Kantarci et al., 2015
pou3f3b Fig. 5 with image from Kantarci et al., 2015
PHENOTYPE
Phenotype resulting from MO4-tfap2a
Phenotype Figures
otic vesicle has fewer parts of type otic vesicle neuroblast (sensu Vertebrata), abnormal Fig. 2 with image from Kantarci et al., 2015
otic vesicle neuroblast fate specification decreased occurrence, abnormal Fig. 2 with image from Kantarci et al., 2015
otic vesicle neurogenesis decreased occurrence, abnormal Fig. 4 with image from Kantarci et al., 2015
statoacoustic (VIII) ganglion has fewer parts of type statoacoustic (VIII) ganglion neuron, abnormal Fig. 4 with image from Kantarci et al., 2015
statoacoustic (VIII) ganglion neuron differentiation decreased rate, abnormal Fig. 4 with image from Kantarci et al., 2015

Phenotype of all Fish created by or utilizing MO4-tfap2a
Phenotype Fish Conditions Figures
otic vesicle neuroblast fate specification decreased occurrence, abnormal AB + MO4-tfap2a heat shock Fig. 6 with image from Kantarci et al., 2015
statoacoustic (VIII) ganglion has fewer parts of type statoacoustic (VIII) ganglion neuron, abnormal AB + MO4-tfap2a standard conditions Fig. 4 with image from Kantarci et al., 2015
otic vesicle neurogenesis decreased occurrence, abnormal AB + MO4-tfap2a standard conditions Fig. 4 with image from Kantarci et al., 2015
otic vesicle has fewer parts of type otic vesicle neuroblast (sensu Vertebrata), abnormal AB + MO4-tfap2a standard conditions Fig. 2 with image from Kantarci et al., 2015
otic vesicle neuroblast fate specification decreased occurrence, abnormal AB + MO4-tfap2a standard conditions Fig. 2 with image from Kantarci et al., 2015
statoacoustic (VIII) ganglion neuron differentiation decreased rate, abnormal AB + MO4-tfap2a standard conditions Fig. 4 with image from Kantarci et al., 2015
pharyngeal arch cartilage absent, abnormal WT + MO2-foxd3 + MO3-foxd3 + MO4-tfap2a standard conditions Fig. 4 with image from Chen et al., 2014
pharyngeal arch tendon absent, abnormal WT + MO2-foxd3 + MO3-foxd3 + MO4-tfap2a standard conditions Fig. 4 with image from Chen et al., 2014
anterior lateral line aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
lens placode aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
olfactory field aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
post-vent region decreased length, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. S1 with image from Li et al., 2007
extension aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. S1 with image from Li et al., 2007
adenohypophyseal placode aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
trigeminal placode aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
ectodermal placode development decreased occurrence, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
olfactory placode development decreased occurrence, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
otic placode aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
melanocyte absent, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. S1 with image from Li et al., 2007
olfactory pit aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
otic placode formation decreased occurrence, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
lens aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
otic vesicle hypoplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with imageFig. 5 with image from Bhat et al., 2013
epibranchial ganglion aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
neural crest cell development disrupted, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 2 with imageFig. 3 with imageFig. 5 with image from Van Otterloo et al., 2012
melanocyte decreased amount, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. S1 with image from Li et al., 2007
whole organism curved ventral, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. S1 with image from Li et al., 2007
lens morphology, abnormal WT + MO2-foxi1 + MO2-gata3 + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 4 with image from Kwon et al., 2010
olfactory pit morphology, abnormal WT + MO2-foxi1 + MO2-gata3 + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 4 with image from Kwon et al., 2010
OTHER MO4-tfap2a MORPHOLINO PAGESNo links to external sites
CITATIONS (11)