ZFIN ID: ZDB-MRPHLNO-080110-7
Morpholino Name: MO1-krt4
Target: krt4 (1)
Sequence:
5' - AGACCTGGTTGACATGATGCCTGTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-krt4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-krt4 No data available
PHENOTYPE
Phenotype resulting from MO1-krt4
No data available

Phenotype of all Fish created by or utilizing MO1-krt4
Phenotype Fish Conditions Figures
cell migration involved in gastrulation disrupted, abnormal WT + MO1-cyt1 + MO1-krt18 + MO1-krt4 + MO1-krt5 + MO1-krt8 standard conditions Fig. 6 with image from Pei et al., 2007
whole organism dead, abnormal WT + MO1-cyt1 + MO1-krt18 + MO1-krt4 + MO1-krt5 + MO1-krt8 standard conditions Fig. 6 with image from Pei et al., 2007
OTHER MO1-krt4 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)