Morpholino

MO1-foxh1

ID

ZDB-MRPHLNO-080110-1

Name

MO1-foxh1

Previous Names

None

Target

Sequence

5' - TGCTTTGTCATGCTGATGTAGTGGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This is a translation blocking morpholino.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-foxh1

Expressed Gene	Anatomy	Figures
bmp4	(not) presumptive mesoderm	Fig. 2 from Pei et al., 2007
cdc14b	EVL	Fig. 4 from Pei et al., 2007
cyt1	(not) EVL periderm	Fig. 4 , Fig. 5 , Fig. 6 from Pei et al., 2007
egr2b	(not) presumptive rhombomere 3 (not) presumptive rhombomere 5	Fig. 2 from Pei et al., 2007
foxa2	endoderm	Fig. 2 from Pei et al., 2007
gata2a	ectoderm	Fig. 2 from Pei et al., 2007
gsc	(not) axial mesoderm	Fig. 2 from Pei et al., 2007
her5	EVL	Fig. 4 from Pei et al., 2007
hoxb1b	neural plate	Fig. 2 from Pei et al., 2007
krt4	EVL periderm	Fig. 4 from Pei et al., 2007
krt5	(not) EVL periderm	Fig. 4 from Pei et al., 2007
krt8	EVL periderm	Fig. 4 from Pei et al., 2007
krt18a.1	EVL periderm	Fig. 4 from Pei et al., 2007
otx2b	neuroectoderm	Fig. 2 from Pei et al., 2007
pax2a	(not) midbrain hindbrain boundary neural plate neuroectoderm presumptive midbrain hindbrain boundary	Fig. 2 , Fig. 5 , Fig. 6 , Fig. S1 from Pei et al., 2007
pax6a	(not) forebrain neural plate	Fig. 2 from Pei et al., 2007
pcdh8	(not) paraxial mesoderm	Fig. 2 from Pei et al., 2007
shha	(not) notochord	Fig. 2 from Pei et al., 2007
snai1a	(not) paraxial mesoderm presumptive paraxial mesoderm	Fig. 2 , Fig. 6 from Pei et al., 2007
sox17	endoderm (not) presumptive endoderm	Fig. 2 , Fig. 6 from Pei et al., 2007
tbxta	(not) notochord	Fig. 2 from Pei et al., 2007
zic1	neuroectoderm	Fig. S1 from Pei et al., 2007

Phenotype

Phenotype resulting from MO1-foxh1

Phenotype	Fish	Figures
cell migration involved in gastrulation disrupted, abnormal	WT + MO1-foxh1	Fig. 1 , Fig. 3 , Fig. 6 , Fig. S1 from Pei et al., 2007
convergent extension disrupted, abnormal	ml1Tg + MO1-foxh1 (AB/TL)	Fig. 3 from Pei et al., 2007
developmental process delayed, abnormal	WT + MO1-foxh1	Fig. 1 from Pei et al., 2007
notochord aplastic, abnormal	foxh1^pr1/pr1 + MO1-foxh1	Fig. S2 from Slagle et al., 2011
whole organism dead, abnormal	WT + MO1-foxh1	Fig. 1 , Fig. 6 , Fig. S1 from Pei et al., 2007

Phenotype of all Fish created by or utilizing MO1-foxh1

Phenotype	Fish	Conditions	Figures
notochord aplastic, abnormal	foxh1^m768/m768 + MO1-foxh1	standard conditions	Fig. S2 from Slagle et al., 2011
notochord aplastic, abnormal	foxh1^pr1/pr1 + MO1-foxh1	standard conditions	Fig. S2 from Slagle et al., 2011
developmental process delayed, abnormal	WT + MO1-foxh1	standard conditions	Fig. 1 from Pei et al., 2007
cell migration involved in gastrulation disrupted, abnormal	WT + MO1-foxh1	standard conditions	Fig. 1 , Fig. 3 , Fig. 6 , Fig. S1 from Pei et al., 2007
whole organism dead, abnormal	WT + MO1-foxh1	standard conditions	Fig. 1 , Fig. 6 , Fig. S1 from Pei et al., 2007
convergent extension disrupted, abnormal	ml1Tg + MO1-foxh1 (AB/TL)	standard conditions	Fig. 3 from Pei et al., 2007
cell migration involved in gastrulation disrupted, abnormal	ml1Tg + MO1-foxh1 (AB/TL)	standard conditions	Fig. 3 from Pei et al., 2007

Citations