ZFIN ID: ZDB-MRPHLNO-080110-1
Morpholino Name: MO1-foxh1
Target: foxh1 (1)
Sequence:
5' - TGCTTTGTCATGCTGATGTAGTGGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a translation blocking morpholino.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-foxh1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-foxh1
Expressed Gene Anatomy Figures
bmp4 Fig. 2 with image from Pei et al., 2007
cdc14b Fig. 4 with image from Pei et al., 2007
cyt1 Fig. 4 with imageFig. 5 with imageFig. 6 with image from Pei et al., 2007
egr2b Fig. 2 with image from Pei et al., 2007
foxa2 Fig. 2 with image from Pei et al., 2007
gata2a Fig. 2 with image from Pei et al., 2007
gsc Fig. 2 with image from Pei et al., 2007
her5 Fig. 4 with image from Pei et al., 2007
hoxb1b Fig. 2 with image from Pei et al., 2007
krt4 Fig. 4 with image from Pei et al., 2007
krt5 Fig. 4 with image from Pei et al., 2007
krt8 Fig. 4 with image from Pei et al., 2007
krt18a.1 Fig. 4 with image from Pei et al., 2007
otx2b Fig. 2 with image from Pei et al., 2007
pax2a Fig. 2 with imageFig. 5 with imageFig. 6 with imageFig. S1 with image from Pei et al., 2007
pax6a Fig. 2 with image from Pei et al., 2007
pcdh8 Fig. 2 with image from Pei et al., 2007
shha Fig. 2 with image from Pei et al., 2007
snai1a Fig. 2 with imageFig. 6 with image from Pei et al., 2007
sox17 Fig. 2 with imageFig. 6 with image from Pei et al., 2007
tbxta Fig. 2 with image from Pei et al., 2007
zic1 Fig. S1 with image from Pei et al., 2007
PHENOTYPE
Phenotype resulting from MO1-foxh1
Phenotype Figures
cell migration involved in gastrulation disrupted, abnormal Fig. 1 with imageFig. 3 with imageFig. 6 with imageFig. S1 with image from Pei et al., 2007
convergent extension disrupted, abnormal Fig. 3 with image from Pei et al., 2007
developmental process delayed, abnormal Fig. 1 with image from Pei et al., 2007
notochord aplastic, abnormal Fig. S2 with image from Slagle et al., 2011
whole organism dead, abnormal Fig. 1 with imageFig. 6 with imageFig. S1 with image from Pei et al., 2007

Phenotype of all Fish created by or utilizing MO1-foxh1
Phenotype Fish Conditions Figures
notochord aplastic, abnormal foxh1m768/m768 + MO1-foxh1 standard conditions Fig. S2 with image from Slagle et al., 2011
notochord aplastic, abnormal foxh1pr1/pr1 + MO1-foxh1 standard conditions Fig. S2 with image from Slagle et al., 2011
developmental process delayed, abnormal WT + MO1-foxh1 standard conditions Fig. 1 with image from Pei et al., 2007
cell migration involved in gastrulation disrupted, abnormal WT + MO1-foxh1 standard conditions Fig. 1 with imageFig. 3 with imageFig. 6 with imageFig. S1 with image from Pei et al., 2007
whole organism dead, abnormal WT + MO1-foxh1 standard conditions Fig. 1 with imageFig. 6 with imageFig. S1 with image from Pei et al., 2007
convergent extension disrupted, abnormal ml1Tg + MO1-foxh1(AB/TL) standard conditions Fig. 3 with image from Pei et al., 2007
cell migration involved in gastrulation disrupted, abnormal ml1Tg + MO1-foxh1(AB/TL) standard conditions Fig. 3 with image from Pei et al., 2007
OTHER MO1-foxh1 MORPHOLINO PAGESNo links to external sites
CITATIONS (6)