header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080110-1
Morpholino Name: MO1-foxh1
Target: foxh1 (1)
Sequence:
5' - TGCTTTGTCATGCTGATGTAGTGGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a translation blocking morpholino.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-foxh1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-foxh1
Expressed Gene Anatomy Figures
bmp4 Fig. 2 with image from Pei et al., 2007
cdc14b Fig. 4 with image from Pei et al., 2007
cyt1 Fig. 4 with imageFig. 5 with imageFig. 6 with image from Pei et al., 2007
egr2b Fig. 2 with image from Pei et al., 2007
foxa2 Fig. 2 with image from Pei et al., 2007
gata2a Fig. 2 with image from Pei et al., 2007
gsc Fig. 2 with image from Pei et al., 2007
her5 Fig. 4 with image from Pei et al., 2007
hoxb1b Fig. 2 with image from Pei et al., 2007
krt4 Fig. 4 with image from Pei et al., 2007
krt5 Fig. 4 with image from Pei et al., 2007
krt8 Fig. 4 with image from Pei et al., 2007
krt18a.1 Fig. 4 with image from Pei et al., 2007
otx2b Fig. 2 with image from Pei et al., 2007
pax2a Fig. 2 with imageFig. 5 with imageFig. 6 with imageFig. S1 with image from Pei et al., 2007
pax6a Fig. 2 with image from Pei et al., 2007
pcdh8 Fig. 2 with image from Pei et al., 2007
shha Fig. 2 with image from Pei et al., 2007
snai1a Fig. 2 with imageFig. 6 with image from Pei et al., 2007
sox17 Fig. 2 with imageFig. 6 with image from Pei et al., 2007
tbxta Fig. 2 with image from Pei et al., 2007
zic1 Fig. S1 with image from Pei et al., 2007
PHENOTYPE
Phenotype resulting from MO1-foxh1
Phenotype of all Fish created by or utilizing MO1-foxh1
OTHER MO1-foxh1 MORPHOLINO PAGESNo links to external sites
CITATIONS (6)