header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070629-3
Morpholino Name: MO1-mtor
Target: mtor (1)
Previous Name: MO1-frap1

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGTTTGACACATTACCCTGAGCATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-mtor No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-mtor
Expressed Gene Anatomy Figures
fabp2 Fig. 7 from Makky et al., 2007
PHENOTYPE
Phenotype resulting from MO1-mtor
Phenotype of all Fish created by or utilizing MO1-mtor
OTHER MO1-mtor MORPHOLINO PAGESNo links to external sites
CITATIONS (3)