header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070622-1
Morpholino Name: MO5-notch1a
Target: notch1a (1)
Sequence:
5' - GTAGTGTTAAACTGTTACCTTGTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: blocks splicing at exon1-intron1 boundary
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-notch1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-notch1a
Expressed Gene Anatomy Figures
dlc Fig. S4 from Kim et al., 2014
efnb2a Fig. S4 from Kim et al., 2014
foxc1b Fig. S4 from Kim et al., 2014
gata2a Fig. 7 with image from Butko et al., 2015
gata2b Fig. 7 with image from Butko et al., 2015
kdrl Fig. S4 from Kim et al., 2014
myod1 Fig. S4 from Kim et al., 2014
runx1 Fig. 7 with image from Butko et al., 2015
Fig. S4 from Kim et al., 2014
twist1b Fig. S4 from Kim et al., 2014
PHENOTYPE
Phenotype resulting from MO5-notch1a
Phenotype of all Fish created by or utilizing MO5-notch1a
OTHER MO5-notch1a MORPHOLINO PAGESNo links to external sites
CITATIONS (6)