ZFIN ID: ZDB-MRPHLNO-070612-8
Morpholino Name: MO4-otpb
Target: otpb (1)
Previous Name: ATG otpb MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCACTGCTGGAGTCACAACTGCTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: The sequence in the publication was incorrect and has been corrected.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-otpb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-otpb
Expressed Gene Anatomy Figures
otpb Fig. S7 from Ryu et al., 2007
th Fig. S7 from Ryu et al., 2007
PHENOTYPE
Phenotype resulting from MO4-otpb
No data available

Phenotype of all Fish created by or utilizing MO4-otpb
No data available
OTHER MO4-otpb MORPHOLINO PAGESNo links to external sites
CITATIONS (1)