header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070410-4
Morpholino Name: MO2-lft2
Target: lft2 (1)
Sequence:
5' - AGCTGGATGAACAGAGCCATGCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-lft2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-lft2
Expressed Gene Anatomy Figures
gsc Fig. S6 from Choi et al., 2007
PHENOTYPE
Phenotype resulting from MO2-lft2
No data available

Phenotype of all Fish created by or utilizing MO2-lft2
OTHER MO2-lft2 MORPHOLINO PAGES No links to external sites
CITATIONS (3)