Morpholino

MO2-lft2

ID
ZDB-MRPHLNO-070410-4
Name
MO2-lft2
Previous Names
None
Target
Sequence
5' - AGCTGGATGAACAGAGCCATGCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-lft2
Expressed Gene Anatomy Figures
gsc Fig. S6 from Choi et al., 2007
Phenotype
Phenotype resulting from MO2-lft2
No data available
Phenotype of all Fish created by or utilizing MO2-lft2
Citations