ZFIN ID: ZDB-MRPHLNO-070328-6
Morpholino Name: MO1-ntn1b
Target: ntn1b (1)
Sequence:
5' - CGCACGTTACCAAAATCCTTATCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ntn1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ntn1b No data available
PHENOTYPE 
Phenotype resulting from MO1-ntn1b
Phenotype Figures
anterior commissure axon extension process quality, abnormal Fig. 7 from Zhang et al., 2012
anterior commissure morphogenesis process quality, abnormal Fig. 7 from Zhang et al., 2012
supraoptic tract axon extension process quality, abnormal Fig. 7 from Zhang et al., 2012

Phenotype of all Fish created by or utilizing MO1-ntn1b
Phenotype Fish Conditions Figures
supraoptic tract axon extension process quality, abnormal b1204Tg + MO1-ntn1b standard conditions Fig. 7 from Zhang et al., 2012
anterior commissure morphogenesis process quality, abnormal b1204Tg + MO1-ntn1b standard conditions Fig. 7 from Zhang et al., 2012
anterior commissure axon extension process quality, abnormal b1204Tg + MO1-ntn1b standard conditions Fig. 7 from Zhang et al., 2012
olfactory bulb axon guidance disrupted, abnormal p201Tg; p202Tg + MO1-ntn1b standard conditions Fig. 5Fig. 8 from Lakhina et al., 2012
olfactory receptor cell axon attached to dorsal zone olfactory bulb, abnormal p201Tg; p202Tg + MO1-ntn1b standard conditions Fig. 5 from Lakhina et al., 2012
olfactory receptor cell axon attached to anteromedial zone olfactory bulb, abnormal p201Tg; p202Tg + MO1-ntn1b standard conditions Fig. 8 from Lakhina et al., 2012
olfactory receptor cell axon attached to medial protoglomerulus, abnormal p201Tg; p202Tg + MO1-ntn1b standard conditions Fig. 5 from Lakhina et al., 2012
olfactory receptor cell axon position, abnormal p201Tg; p202Tg + MO1-ntn1b standard conditions Fig. 5Fig. 8 from Lakhina et al., 2012
olfactory receptor cell axon posterior to olfactory bulb, abnormal p201Tg; p202Tg + MO1-ntn1b standard conditions Fig. 8 from Lakhina et al., 2012
dopaminergic neuron axon adjacent to spinal cord axis, abnormal robo2ti272z/ti272z + MO1-ntn1b standard conditions Fig. T1 from Kastenhuber et al., 2009
dopaminergic neuron axon mislocalised medially, abnormal robo2ti272z/ti272z + MO1-ntn1b standard conditions Fig. T1 from Kastenhuber et al., 2009
dopaminergic neuron axon adjacent to hindbrain axis, abnormal robo2ti272z/ti272z + MO1-ntn1b standard conditions Fig. T1 from Kastenhuber et al., 2009
anterior/posterior axon guidance disrupted, abnormal robo2ti272z/ti272z + MO1-ntn1b standard conditions Fig. T1 from Kastenhuber et al., 2009
dorso-rostral cluster neuron projection mislocalised, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection physical object quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster neuron projection mislocalised dorsally, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection misrouted, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
anterior commissure morphogenesis process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
supraoptic tract axon extension process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
dendrite development disrupted, abnormal rw0Tg + MO1-ntn1b + MO2-ntn1a standard conditions Fig. 4 from Suli et al., 2006
efferent neuron dendrite mislocalised, abnormal rw0Tg + MO1-ntn1b + MO2-ntn1a standard conditions Fig. 4 from Suli et al., 2006
efferent neuron dendrite decreased amount, abnormal rw0Tg + MO1-ntn1b + MO2-ntn1a standard conditions Fig. 4 from Suli et al., 2006
dorso-rostral cluster neuron projection mislocalised dorsally, abnormal b1204Tg + MO1-dcc + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster neuron projection physical object quality, abnormal b1204Tg + MO1-dcc + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO1-dcc + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster neuron projection misrouted, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
anterior commissure morphogenesis process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection mislocalised, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
supraoptic tract axon extension process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
olfactory bulb axon guidance disrupted, abnormal p201Tg; p202Tg + MO1-ntn1b + MO2-ntn1a standard conditions Fig. 5Fig. 8 from Lakhina et al., 2012
olfactory receptor cell axon attached to medial protoglomerulus, abnormal p201Tg; p202Tg + MO1-ntn1b + MO2-ntn1a standard conditions Fig. 5 from Lakhina et al., 2012
olfactory receptor cell axon position, abnormal p201Tg; p202Tg + MO1-ntn1b + MO2-ntn1a standard conditions Fig. 5Fig. 8 from Lakhina et al., 2012
olfactory receptor cell axon posterior to olfactory bulb, abnormal p201Tg; p202Tg + MO1-ntn1b + MO2-ntn1a standard conditions Fig. 8 from Lakhina et al., 2012
olfactory receptor cell axon attached to dorsal zone olfactory bulb, abnormal p201Tg; p202Tg + MO1-ntn1b + MO2-ntn1a standard conditions Fig. 5 from Lakhina et al., 2012
olfactory receptor cell axon attached to anteromedial zone olfactory bulb, abnormal p201Tg; p202Tg + MO1-ntn1b + MO2-ntn1a standard conditions Fig. 8 from Lakhina et al., 2012
olfactory receptor cell axon attached to ventral zone olfactory bulb, abnormal p201Tg; p202Tg + MO1-ntn1b + MO2-ntn1a standard conditions Fig. 8 from Lakhina et al., 2012
OTHER MO1-ntn1b MORPHOLINO PAGESNo links to external sites
CITATIONS (8)