ZFIN ID: ZDB-MRPHLNO-060831-4
Morpholino Name: MO2-fgf4
Target: fgf4 (1)
Previous Name: Fgf4 MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCTACCGTTTTTCTCTATGCTTGAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-fgf4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-fgf4
Expressed Gene Anatomy Figures
fgf16 Fig. 5 from Nomura et al., 2006
foxa3 Fig. 2 with image from Yamauchi et al., 2009
myl7 Fig. 2 with image from Yamauchi et al., 2009
PHENOTYPE
Phenotype resulting from MO2-fgf4
Phenotype Figures
determination of heart left/right asymmetry disrupted, abnormal Fig. 2 with image from Yamauchi et al., 2009
determination of liver left/right asymmetry disrupted, abnormal Fig. 2 with image from Yamauchi et al., 2009
determination of pancreatic left/right asymmetry disrupted, abnormal Fig. 2 with image from Yamauchi et al., 2009
heart mislocalised, abnormal Fig. 2 with image from Yamauchi et al., 2009
Kupffer's vesicle cilium decreased length, abnormal Fig. 3 with image from Gao et al., 2017
liver mislocalised, abnormal Fig. 2 with image from Yamauchi et al., 2009
pancreas mislocalised, abnormal Fig. 2 with image from Yamauchi et al., 2009

Phenotype of all Fish created by or utilizing MO2-fgf4
Phenotype Fish Conditions Figures
Kupffer's vesicle cilium decreased length, abnormal TU + MO2-fgf4 standard conditions Fig. 3 with image from Gao et al., 2017
pancreas mislocalised, abnormal WT + MO2-fgf4 standard conditions Fig. 2 with image from Yamauchi et al., 2009
determination of liver left/right asymmetry disrupted, abnormal WT + MO2-fgf4 standard conditions Fig. 2 with image from Yamauchi et al., 2009
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO2-fgf4 standard conditions Fig. 2 with image from Yamauchi et al., 2009
determination of heart left/right asymmetry disrupted, abnormal WT + MO2-fgf4 standard conditions Fig. 2 with image from Yamauchi et al., 2009
liver mislocalised, abnormal WT + MO2-fgf4 standard conditions Fig. 2 with image from Yamauchi et al., 2009
heart mislocalised, abnormal WT + MO2-fgf4 standard conditions Fig. 2 with image from Yamauchi et al., 2009
OTHER MO2-fgf4 MORPHOLINO PAGESNo links to external sites
CITATIONS (3)