header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060821-1
Morpholino Name: MO1-krit1
Target: krit1 (1)
Sequence:
5' - GCTTTATTTCACCTCACCTCATAGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets the exon 1 donor site.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-krit1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-krit1 No data available
PHENOTYPE
Phenotype resulting from MO1-krit1
Phenotype of all Fish created by or utilizing MO1-krit1
Phenotype Fish Conditions Figures
atrium dilated, abnormal TU + MO1-krit1 standard conditions Fig. 4 with image from Rosen et al., 2013
sinus venosus dilated, abnormal TU + MO1-krit1 standard conditions Fig. 4 with image from Rosen et al., 2013
heart increased size, abnormal WT + MO1-krit1 standard conditions Fig. S6 from Gore et al., 2008
blood circulation disrupted, abnormal WT + MO1-krit1 standard conditions Fig. S6 from Gore et al., 2008
caudal vein plexus sprouting angiogenesis increased occurrence, abnormal s843Tg + MO1-krit1 standard conditions Fig. 6Fig. 7 from Mleynek et al., 2014
caudal vein plexus angiogenic sprout increased amount, abnormal s843Tg + MO1-krit1 standard conditions Fig. 6Fig. 7 from Mleynek et al., 2014
blood vessel morphogenesis decreased process quality, abnormal s843Tg + MO1-krit1 standard conditions Fig. 6Fig. 7 from Mleynek et al., 2014
post-vent vasculature morphology, abnormal s843Tg + MO1-krit1 standard conditions Fig. 6Fig. 7 from Mleynek et al., 2014
vascular endothelium apoptotic, abnormal y1Tg + MO1-krit1 + MO2-krit1(AB) standard conditions Fig. 4Fig. 5 from Liu et al., 2010
angiogenesis process quality, abnormal y1Tg + MO1-krit1 + MO2-krit1(AB) standard conditions Fig. S3 from Liu et al., 2011
blood vessel lumenization process quality, abnormal y1Tg + MO1-krit1 + MO2-krit1(AB) standard conditions Fig. S3 from Liu et al., 2011
intersegmental vessel malformed, abnormal y1Tg + MO1-krit1 + MO2-krit1(AB) standard conditions Fig. S3 from Liu et al., 2011
heart increased size, abnormal y1Tg + MO1-krit1 + MO2-krit1(AB) standard conditions Fig. S3 from Liu et al., 2011
intersegmental vessel unlumenized, abnormal y1Tg + MO1-krit1 + MO2-krit1(AB) standard conditions Fig. S3 from Liu et al., 2011
blood circulation process quality, abnormal y1Tg + MO1-krit1 + MO2-krit1(AB) standard conditions Fig. S3 from Liu et al., 2011
sinus venosus dilated, abnormal TU + MO1-ccm2l + MO1-krit1 standard conditions Fig. 4 with image from Rosen et al., 2013
blood circulation arrested, abnormal TU + MO1-ccm2l + MO1-krit1 standard conditions Fig. 4 with image from Rosen et al., 2013
atrium dilated, abnormal TU + MO1-ccm2l + MO1-krit1 standard conditions Fig. 4 with image from Rosen et al., 2013
sinus venosus dilated, abnormal TU + MO1-krit1 + MO2-ccm2l standard conditions Fig. 4 with image from Rosen et al., 2013
blood circulation arrested, abnormal TU + MO1-krit1 + MO2-ccm2l standard conditions Fig. 4 with image from Rosen et al., 2013
atrium dilated, abnormal TU + MO1-krit1 + MO2-ccm2l standard conditions Fig. 4 with image from Rosen et al., 2013
Genome Resources:
CITATIONS (6)