header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060601-8
Morpholino Name: MO2-spry4
Target: spry4 (1)
Sequence:
5' - GCTCAGCATTTAGCACTCTTGCATT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-spry4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-spry4
Expressed Gene Anatomy Figures
hbae1.1 Fig. 4 from Eckfeldt et al., 2005
lcp1 Fig. 4 from Eckfeldt et al., 2005
PHENOTYPE
Phenotype resulting from MO2-spry4
No data available

Phenotype of all Fish created by or utilizing MO2-spry4
OTHER MO2-spry4 MORPHOLINO PAGES
  • MODB:581 (2)
  • CITATIONS (3)