Morpholino

MO1-fgfr1a

ID
ZDB-MRPHLNO-060222-1
Name
MO1-fgfr1a
Previous Names
  • MO1-fgfr1
Target
Sequence
5' - GCAGCAGCGTGGTCTTCATTATCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fgfr1a
Phenotype
Phenotype resulting from MO1-fgfr1a
Phenotype of all Fish created by or utilizing MO1-fgfr1a
Phenotype Fish Conditions Figures
Kupffer's vesicle cilium decreased length, abnormal TU + MO1-fgfr1a standard conditions Fig. 3 with image from Gao et al., 2017
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-fgfr1a standard conditions Fig. 4 with image from Liu et al., 2011
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-fgfr1a standard conditions Fig. 4 with image from Liu et al., 2011
olfactory nerve formation process quality, abnormal rw037Tg + MO1-fgfr1a standard conditions Fig. 4 from Garaffo et al., 2013
olfactory bulb glomerulus morphology, abnormal rw037Tg + MO1-fgfr1a standard conditions Fig. 4 from Garaffo et al., 2013
olfactory bulb glomerulus malformed, abnormal rw037Tg + MO1-fgfr1a standard conditions Fig. 4 from Garaffo et al., 2013
olfactory epithelium morphology, abnormal rw037Tg + MO1-fgfr1a standard conditions Fig. 4 from Garaffo et al., 2013
cranial nerve I axon mislocalised, abnormal rw037Tg + MO1-fgfr1a standard conditions Fig. 4 from Garaffo et al., 2013
post-vent region has fewer parts of type mesoderm, abnormal WT + MO1-fgfr1a + MO1-fgfr1b standard conditions Fig. S6 with image from Rohner et al., 2009
post-vent region malformed, abnormal WT + MO1-fgfr1a + MO1-fgfr1b standard conditions Fig. S6 with image from Rohner et al., 2009
trunk shortened, abnormal WT + MO1-fgfr1a + MO1-fgfr1b standard conditions Fig. 2 from Hong et al., 2016
post-vent region shortened, abnormal WT + MO1-fgfr1a + MO1-fgfr1b standard conditions Fig. 2 from Hong et al., 2016
post-anal tail morphogenesis process quality, abnormal WT + MO1-fgfr1a + MO1-fgfr1b standard conditions Fig. S6 with image from Rohner et al., 2009
Citations