ZFIN ID: ZDB-MRPHLNO-060118-2
Morpholino Name: MO1-mpp5a
Target: mpp5a (1)
Previous Names: MO1-mpp5, nokMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGAGGTCAGCAGCGGCTCCAAACAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-mpp5a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-mpp5a
Expressed Gene Anatomy Figures
myl7 Fig. 1 with image from Rohr et al., 2006
pax2a Fig. 8 with image from Gerlach et al., 2014
podxl Fig. 8 with image from Gerlach et al., 2014
tjp1a Fig. 4 with imageFig. 5 with image from Rohr et al., 2006
wt1a Fig. 8 with image from Gerlach et al., 2014
Fig. 7 with image from Serluca, 2008
PHENOTYPE
Phenotype resulting from MO1-mpp5a
Phenotype Figures
establishment or maintenance of epithelial cell apical/basal polarity process quality, abnormal Fig. 8 with image from Gerlach et al., 2014
heart morphogenesis process quality, abnormal Fig. 3 from Rohr et al., 2008
pericardium edematous, abnormal Fig. 7 with image from Serluca, 2008

Phenotype of all Fish created by or utilizing MO1-mpp5a
Phenotype Fish Conditions Figures
establishment or maintenance of epithelial cell apical/basal polarity process quality, abnormal TU + MO1-mpp5a standard conditions Fig. 8 with image from Gerlach et al., 2014
pericardium edematous, abnormal WT + MO1-mpp5a standard conditions Fig. 7 with image from Serluca, 2008
heart morphogenesis process quality, abnormal twu34Tg + MO1-mpp5a standard conditions Fig. 3 from Rohr et al., 2008
OTHER MO1-mpp5a MORPHOLINO PAGESNo links to external sites
CITATIONS (4)