header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060113-5
Morpholino Name: MO1-ripply1
Target: ripply1 (1)
Sequence:
5' - CATCGTCACTGTGTTTTTCGTTTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ripply1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ripply1
Expressed Gene Anatomy Figures
dlc Fig. 4 from Kawamura et al., 2005
dld Fig. 4 from Kawamura et al., 2005
fgf8a Fig. 4 from Kawamura et al., 2005
her1 Fig. 4 from Kawamura et al., 2005
hes6 Fig. 4 from Kawamura et al., 2005
mespaa Fig. 6 with image from Moreno et al., 2008
Fig. 4 from Kawamura et al., 2005
mespba Fig. 1 from Kawamura et al., 2008
Fig. 6 with image from Moreno et al., 2008
Fig. 4Fig. 5 from Kawamura et al., 2005
myod1 Fig. 4 from Kawamura et al., 2005
pax9 Fig. 4 from Kawamura et al., 2005
pcdh8 Fig. 4 from Kawamura et al., 2005
ripply2 Fig. 4 from Kawamura et al., 2005
tbx6 Fig. 4 with image from Wanglar et al., 2014
Fig. 4 from Kawamura et al., 2005
tbxta Fig. 1 from Kawamura et al., 2008
PHENOTYPE
Phenotype resulting from MO1-ripply1
Phenotype Figures
dermomyotome increased amount, abnormal Fig. 5 with image from Windner et al., 2015
paraxial mesoderm tbx6 expression increased amount, abnormal Fig. 4 with image from Windner et al., 2015
paraxial mesoderm tbx6 expression increased distribution, abnormal Fig. 4 with image from Windner et al., 2015
segment polarity determination disrupted, abnormal Fig. 4 from Kawamura et al., 2005
segmental plate mespba expression increased distribution, abnormal Fig. 4 with image from Windner et al., 2015
segmental plate mespbb expression increased distribution, abnormal Fig. 4 with image from Windner et al., 2015
slow muscle cell mislocalised, abnormal Fig. 5 with image from Windner et al., 2015
slow muscle myoblast ab-mf20 labeling increased amount, abnormal Fig. 4 with image from Windner et al., 2015
somite pax3a expression decreased amount, abnormal Fig. 5 with image from Windner et al., 2015
somite meox1 expression increased amount, abnormal Fig. 5 with image from Windner et al., 2015
somite border absent, abnormal Fig. 3 from Kawamura et al., 2005
somitogenesis disrupted, abnormal Fig. 3Fig. 4 from Kawamura et al., 2005
trunk ab-pax7 labeling increased distribution, abnormal Fig. 5 with image from Windner et al., 2015
trunk pax7a expression increased distribution, abnormal Fig. 5 with image from Windner et al., 2015
trunk pax3a expression increased distribution, abnormal Fig. 5 with image from Windner et al., 2015
trunk posterior region tbx6 expression increased distribution, abnormal Fig. 5 with image from Windner et al., 2015
trunk posterior region tbx6 expression mislocalised, abnormal Fig. 5 with image from Windner et al., 2015

Phenotype of all Fish created by or utilizing MO1-ripply1
Phenotype Fish Conditions Figures
segment polarity determination disrupted, abnormal TL + MO1-ripply1 standard conditions Fig. 4 from Kawamura et al., 2005
somite border absent, abnormal TL + MO1-ripply1 standard conditions Fig. 3 from Kawamura et al., 2005
somitogenesis disrupted, abnormal TL + MO1-ripply1 standard conditions Fig. 3Fig. 4 from Kawamura et al., 2005
trunk posterior region tbx6 expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
trunk posterior region tbx6 expression mislocalised, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
dermomyotome increased amount, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
segmental plate mespba expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
paraxial mesoderm tbx6 expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
somite meox1 expression increased amount, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
slow muscle cell mislocalised, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
somite pax3a expression decreased amount, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
segmental plate mespbb expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
trunk pax7a expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
trunk ab-pax7 labeling increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
trunk pax3a expression increased distribution, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 5 with image from Windner et al., 2015
paraxial mesoderm tbx6 expression increased amount, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
slow muscle myoblast ab-mf20 labeling increased amount, abnormal WT + MO1-ripply1 + MO4-tp53 control Fig. 4 with image from Windner et al., 2015
OTHER MO1-ripply1 MORPHOLINO PAGESNo links to external sites
CITATIONS (6)