ZFIN ID: ZDB-MRPHLNO-060109-4
Morpholino Name: MO2-rx2
Target: rx2 (1)
Previous Name: rx2GT-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTTTCTGGCGCTCACCTGAACTCGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: The 5' end of this splice blocking morpholino may not match the target genomic sequence in intron 2 completely.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-rx2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-rx2 No data available
PHENOTYPE
Phenotype resulting from MO2-rx2
No data available

Phenotype of all Fish created by or utilizing MO2-rx2
Genome Resources:
CITATIONS (2)