ZFIN ID: ZDB-MRPHLNO-051220-4
Morpholino Name: MO1-sox10
Target: sox10 (1)
Previous Name: SMO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ATGCTGTGCTCCTCCGCCGACATCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-sox10 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-sox10
Expressed Gene Anatomy Figures
agr2 Fig. 7 from Tang et al., 2014
atoh1a Fig. 8 from Tang et al., 2014
bmp4 Fig. 8 from Tang et al., 2014
cdh5 Fig. 6 from Damm et al., 2017
crestin Fig. 5 from Damm et al., 2017
dct Fig. 4 from Asad et al., 2016
dlx2a Fig. 7 from Asad et al., 2016
dlx3b Fig. 8 from Tang et al., 2014
efnb2a Fig. 6 from Damm et al., 2017
eya1 Fig. 8 from Tang et al., 2014
foxd3 Fig. 6 from Asad et al., 2016
gata1a Fig. 6 from Damm et al., 2017
gata2b Fig. 6 from Damm et al., 2017
gnrh2 Fig. 3 with image from Whitlock et al., 2005
gnrh3 Fig. 4 with image from Whitlock et al., 2005
mbpa Fig. 6 from Asad et al., 2016
mitfa Fig. 4 from Asad et al., 2016
myb Fig. 5 from Damm et al., 2017
notch1b Fig. 6 from Damm et al., 2017
rag1 Fig. 5 from Damm et al., 2017
runx1 Fig. 5 from Damm et al., 2017
sox2 Fig. 8 from Tang et al., 2014
sox9a Fig. 7 from Asad et al., 2016
sox9b Fig. 7 from Asad et al., 2016
tal1 Fig. 6 from Damm et al., 2017
tyr Fig. 4 from Asad et al., 2016
PHENOTYPE
Phenotype resulting from MO1-sox10
Phenotype Figures
anterior crista physical object quality, abnormal Fig. 10 from Tang et al., 2014
ceratobranchial cartilage absent, abnormal Fig. 7 from Asad et al., 2016
developmental growth decreased rate, abnormal Fig. 6 from Kamei et al., 2018
hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal Fig. 5 from Damm et al., 2017
hematopoietic multipotent progenitor cell decreased amount, abnormal Fig. 5 from Damm et al., 2017
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal Fig. 5 from Damm et al., 2017
hematopoietic progenitor cell differentiation decreased occurrence, abnormal Fig. 5 from Damm et al., 2017
inner ear morphogenesis decreased process quality, abnormal Fig. 7Fig. 8Fig. 10 from Tang et al., 2014
lateral crista physical object quality, abnormal Fig. 10 from Tang et al., 2014
lateral crista primordium physical object quality, abnormal Fig. 8 from Tang et al., 2014
macula utricle physical object quality, abnormal Fig. 7Fig. 10 from Tang et al., 2014
melanocyte absent, abnormal Fig. 2 with image from Whitlock et al., 2005
melanocyte dct expression decreased amount, abnormal Fig. 4 from Asad et al., 2016
myelinating Schwann cell mbpa expression decreased amount, abnormal Fig. 6 from Asad et al., 2016
myelinating Schwann cell mbpa expression decreased distribution, abnormal Fig. 6 from Asad et al., 2016
myelinating Schwann cell myelination disrupted, abnormal Fig. 6 from Asad et al., 2016
olfactory epithelium lacks parts or has fewer parts of type olfactory epithelium microvillous olfactory receptor neuron, abnormal Fig. 5 with image from Saxena et al., 2013
olfactory epithelium microvillous olfactory receptor neuron disorganized, abnormal Fig. 5 with image from Saxena et al., 2013
otic vesicle anterior region physical object quality, abnormal Fig. 7 from Tang et al., 2014
perichondrium sox9b expression decreased amount, abnormal Fig. 7 from Asad et al., 2016
perichondrium disorganized, abnormal Fig. 7 from Asad et al., 2016
pharyngeal arch chondrocyte sox9a expression decreased amount, abnormal Fig. 7 from Asad et al., 2016
pharyngeal arch neural crest cell dlx2a expression decreased amount, abnormal Fig. 7 from Asad et al., 2016
posterior crista physical object quality, abnormal Fig. 10 from Tang et al., 2014
posterior crista primordium physical object quality, abnormal Fig. 8 from Tang et al., 2014
semicircular canal physical object quality, abnormal Fig. 7Fig. 10 from Tang et al., 2014
T cell decreased amount, abnormal Fig. 5 from Damm et al., 2017
thymus rag1 expression decreased amount, abnormal Fig. 5 from Damm et al., 2017
trunk neural crest cell migration arrested, abnormal Fig. 5 from Damm et al., 2017
ventral mandibular arch morphology, abnormal Fig. 7 from Asad et al., 2016
whole organism tyr expression absent, abnormal Fig. 4 from Asad et al., 2016
whole organism mitfa expression absent, abnormal Fig. 4 from Asad et al., 2016
whole organism decreased pigmentation, abnormal Fig. S4 from Asad et al., 2016
whole organism Melanin decreased amount, abnormal Fig. S4 from Asad et al., 2016

Phenotype of all Fish created by or utilizing MO1-sox10
Phenotype Fish Conditions Figures
pharyngeal arch chondrocyte sox9a expression decreased amount, abnormal TU + MO1-sox10 standard conditions Fig. 7 from Asad et al., 2016
myelinating Schwann cell myelination disrupted, abnormal TU + MO1-sox10 standard conditions Fig. 6 from Asad et al., 2016
myelinating Schwann cell mbpa expression decreased amount, abnormal TU + MO1-sox10 standard conditions Fig. 6 from Asad et al., 2016
myelinating Schwann cell mbpa expression decreased distribution, abnormal TU + MO1-sox10 standard conditions Fig. 6 from Asad et al., 2016
melanocyte dct expression decreased amount, abnormal TU + MO1-sox10 standard conditions Fig. 4 from Asad et al., 2016
perichondrium sox9b expression decreased amount, abnormal TU + MO1-sox10 standard conditions Fig. 7 from Asad et al., 2016
whole organism mitfa expression absent, abnormal TU + MO1-sox10 standard conditions Fig. 4 from Asad et al., 2016
perichondrium disorganized, abnormal TU + MO1-sox10 standard conditions Fig. 7 from Asad et al., 2016
pharyngeal arch neural crest cell dlx2a expression decreased amount, abnormal TU + MO1-sox10 standard conditions Fig. 7 from Asad et al., 2016
ventral mandibular arch morphology, abnormal TU + MO1-sox10 standard conditions Fig. 7 from Asad et al., 2016
whole organism tyr expression absent, abnormal TU + MO1-sox10 standard conditions Fig. 4 from Asad et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal WIK + MO1-sox10 standard conditions Fig. 5 from Damm et al., 2017
hematopoietic progenitor cell differentiation decreased occurrence, abnormal WIK + MO1-sox10 standard conditions Fig. 5 from Damm et al., 2017
hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal WIK + MO1-sox10 standard conditions Fig. 5 from Damm et al., 2017
T cell decreased amount, abnormal WIK + MO1-sox10 standard conditions Fig. 5 from Damm et al., 2017
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal WIK + MO1-sox10 standard conditions Fig. 5 from Damm et al., 2017
trunk neural crest cell migration arrested, abnormal WIK + MO1-sox10 standard conditions Fig. 5 from Damm et al., 2017
thymus rag1 expression decreased amount, abnormal WIK + MO1-sox10 standard conditions Fig. 5 from Damm et al., 2017
developmental growth decreased rate, abnormal WT + MO1-sox10 oxygen content, hypoxia Fig. 6 from Kamei et al., 2018
posterior crista primordium physical object quality, abnormal WT + MO1-sox10 standard conditions Fig. 8 from Tang et al., 2014
macula utricle physical object quality, abnormal WT + MO1-sox10 standard conditions Fig. 7 from Tang et al., 2014
lateral crista primordium physical object quality, abnormal WT + MO1-sox10 standard conditions Fig. 8 from Tang et al., 2014
developmental growth decreased rate, abnormal WT + MO1-sox10 hypoxia Fig. 6 from Kamei et al., 2018
otic vesicle anterior region physical object quality, abnormal WT + MO1-sox10 standard conditions Fig. 7 from Tang et al., 2014
melanocyte absent, abnormal WT + MO1-sox10 standard conditions Fig. 2 with image from Whitlock et al., 2005
semicircular canal physical object quality, abnormal WT + MO1-sox10 standard conditions Fig. 7 from Tang et al., 2014
developmental growth decreased rate, abnormal WT + MO1-sox10 control Fig. 6 from Kamei et al., 2018
inner ear morphogenesis decreased process quality, abnormal WT + MO1-sox10 standard conditions Fig. 7Fig. 8 from Tang et al., 2014
anterior crista physical object quality, abnormal as11Tg + MO1-sox10 standard conditions Fig. 10 from Tang et al., 2014
macula utricle physical object quality, abnormal as11Tg + MO1-sox10 standard conditions Fig. 10 from Tang et al., 2014
inner ear morphogenesis decreased process quality, abnormal as11Tg + MO1-sox10 standard conditions Fig. 10 from Tang et al., 2014
semicircular canal physical object quality, abnormal as11Tg + MO1-sox10 standard conditions Fig. 10 from Tang et al., 2014
lateral crista physical object quality, abnormal as11Tg + MO1-sox10 standard conditions Fig. 10 from Tang et al., 2014
posterior crista physical object quality, abnormal as11Tg + MO1-sox10 standard conditions Fig. 10 from Tang et al., 2014
ceratobranchial cartilage absent, abnormal ba2Tg + MO1-sox10 standard conditions Fig. 7 from Asad et al., 2016
whole organism decreased pigmentation, abnormal w47Tg + MO1-sox10 standard conditions Fig. S4 from Asad et al., 2016
whole organism Melanin decreased amount, abnormal w47Tg + MO1-sox10 standard conditions Fig. S4 from Asad et al., 2016
olfactory epithelium lacks parts or has fewer parts of type olfactory epithelium microvillous olfactory receptor neuron, abnormal ba2Tg; rw035Tg; rw037Tg + MO1-sox10 standard conditions Fig. 5 with image from Saxena et al., 2013
olfactory epithelium microvillous olfactory receptor neuron disorganized, abnormal ba2Tg; rw035Tg; rw037Tg + MO1-sox10 standard conditions Fig. 5 with image from Saxena et al., 2013
olfactory epithelium microvillous olfactory receptor neuron disorganized, abnormal rw035Tg; rw037Tg + MO1-sox10 standard conditions Fig. 5 with image from Saxena et al., 2013
olfactory epithelium lacks parts or has fewer parts of type olfactory epithelium microvillous olfactory receptor neuron, abnormal rw035Tg; rw037Tg + MO1-sox10 standard conditions Fig. 5 with image from Saxena et al., 2013
hematopoietic stem cell decreased amount, abnormal s896Tg; zf169Tg + MO1-sox10 control Fig. 5 from Damm et al., 2017
cranial motor neuron isl2a expression decreased amount, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. S5 from Asad et al., 2016
myelinating Schwann cell myelination process quality, ameliorated TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 6 from Asad et al., 2016
head neuroblast neurod1 expression decreased amount, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. S5 from Asad et al., 2016
pharyngeal arch chondrocyte sox9a expression absent, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
perichondrium sox9b expression decreased amount, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
melanocyte dct expression decreased amount, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 4 from Asad et al., 2016
perichondrium disorganized, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
head melanoblast mitfa expression decreased amount, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 4 from Asad et al., 2016
melanocyte tyr expression decreased amount, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 4 from Asad et al., 2016
pharyngeal arch neural crest cell dlx2a expression decreased amount, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
vagal neural crest crestin expression decreased amount, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. S5 from Asad et al., 2016
myelinating Schwann cell mbpa expression position, ameliorated TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 6 from Asad et al., 2016
neural crest melanoblast mitfa expression decreased amount, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 4 from Asad et al., 2016
ventral mandibular arch morphology, ameliorated TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
Meckel's cartilage morphology, ameliorated ba2Tg + MO1-sox10 + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
ceratobranchial cartilage morphology, ameliorated ba2Tg + MO1-sox10 + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
olfactory receptor cell decreased amount, abnormal ba2Tg + MO1-sox10 + MO8-chd7 standard conditions Fig. S5 from Asad et al., 2016
ceratohyal cartilage morphology, ameliorated ba2Tg + MO1-sox10 + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
whole organism decreased pigmentation, abnormal w47Tg + MO1-sox10 + MO8-chd7 standard conditions Fig. S4 from Asad et al., 2016
enteric neuron decreased amount, abnormal zf148Tg + MO1-sox10 + MO8-chd7 standard conditions Fig. S5 from Asad et al., 2016
Genome Resources:
CITATIONS (7)