ZFIN ID: ZDB-MRPHLNO-051220-2
Morpholino Name: MO1-six3a,six3b
Targets: six3a , six3b
Previous Name: six3-AMO

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCTCTAAAGGAGACCTGAAAACCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: The authors state that this morpholino is also effective at reducing translation of six3a, to which it has a 2-bp mismatch.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-six3a,six3b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-six3a,six3b
Expressed Gene Anatomy Figures
eomesa Fig. 5 with image from Ando et al., 2005
lhx2b Fig. 4 with image from Ando et al., 2005
myod1 Fig. 4 with image from Ando et al., 2005
pax2a Fig. 4 with imageFig. 5 with image from Ando et al., 2005
PHENOTYPE
Phenotype resulting from MO1-six3a,six3b
No data available

Phenotype of all Fish created by or utilizing MO1-six3a,six3b
Phenotype Fish Conditions Figures
retina sensory epithelium regeneration decreased occurrence, abnormal WT + MO1-six3a,six3b light ablation: photoreceptor cell Fig. 5 from Lenkowski et al., 2013
retina stem cell proliferation decreased occurrence, abnormal WT + MO1-six3a,six3b light ablation: photoreceptor cell Fig. 5 from Lenkowski et al., 2013
hypothalamus anterior region mCherry expression absent, abnormal zf997Tg ; zf994Tg + MO1-six3a,six3b(WIK/AB) control Fig. 2 with image from Bhatia et al., 2015
hypothalamus posterior region mCherry expression decreased distribution, abnormal zf997Tg ; zf994Tg + MO1-six3a,six3b(WIK/AB) control Fig. 2 with image from Bhatia et al., 2015
hypothalamus anterior region EGFP expression absent, abnormal zf997Tg ; zf994Tg + MO1-six3a,six3b(WIK/AB) control Fig. 2 with image from Bhatia et al., 2015
hypothalamus posterior region EGFP expression decreased distribution, abnormal zf997Tg ; zf994Tg + MO1-six3a,six3b(WIK/AB) control Fig. 2 with image from Bhatia et al., 2015
OTHER MO1-six3a,six3b MORPHOLINO PAGES
  • MODB:110 (2)
  • CITATIONS (5)