ZFIN ID: ZDB-MRPHLNO-051004-1
Morpholino Name: MO1-stat3
Target: stat3 (1)
Previous Name: Stat3-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCCATGTTGACCCCTTAATGTGTCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-stat3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-stat3
Expressed Gene Anatomy Figures
stat3 Fig. 5 from Kassen et al., 2009
tbxta Fig. 3 with image from Liu et al., 2017
PHENOTYPE
Phenotype resulting from MO1-stat3
Phenotype Figures
anterior macula has fewer parts of type hair cell anterior macula, abnormal Fig. 3 from Liang et al., 2012
Muller cell proliferative, abnormal Fig. 10 from Kassen et al., 2009
neuromast has fewer parts of type hair cell, abnormal Fig. 3 from Liang et al., 2012
notochord decreased length, abnormal Fig. 3 with image from Liu et al., 2017
notochord decreased length, exacerbated Fig. 3 with image from Liu et al., 2017
otic vesicle has fewer parts of type otolith, abnormal Fig. 3 from Liang et al., 2012
posterior lateral line neuromast decreased amount, abnormal Fig. 3 from Liang et al., 2012

Phenotype of all Fish created by or utilizing MO1-stat3
Phenotype Fish Conditions Figures
notochord decreased length, exacerbated stat3stl27/stl27 + MO1-stat3 standard conditions Fig. 3 with image from Liu et al., 2017
Muller cell proliferative, abnormal WT + MO1-stat3 standard conditions Fig. 10 from Kassen et al., 2009
posterior lateral line neuromast decreased amount, abnormal WT + MO1-stat3 standard conditions Fig. 3 from Liang et al., 2012
otic vesicle has fewer parts of type otolith, abnormal WT + MO1-stat3 standard conditions Fig. 3 from Liang et al., 2012
neuromast has fewer parts of type hair cell, abnormal WT + MO1-stat3 standard conditions Fig. 3 from Liang et al., 2012
notochord decreased length, abnormal WT + MO1-stat3 standard conditions Fig. 3 with image from Liu et al., 2017
anterior macula has fewer parts of type hair cell anterior macula, abnormal zf106Tg + MO1-stat3 standard conditions Fig. 3 from Liang et al., 2012
eye photoreceptor cell apoptotic, abnormal slc45a2unspecified + MO1-stat3 standard conditions Fig. 6 from Kassen et al., 2009
OTHER MO1-stat3 MORPHOLINO PAGESNo links to external sites
CITATIONS (7)