header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-051004-1
Morpholino Name: MO1-stat3
Target: stat3 (1)
Previous Name: Stat3-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCCATGTTGACCCCTTAATGTGTCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-stat3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-stat3
Expressed Gene Anatomy Figures
stat3 Fig. 5 from Kassen et al., 2009
tbxta Fig. 3 with image from Liu et al., 2017
PHENOTYPE
Phenotype resulting from MO1-stat3
Phenotype of all Fish created by or utilizing MO1-stat3
OTHER MO1-stat3 MORPHOLINO PAGES No links to external sites
CITATIONS (8)