Morpholino

MO1-aldh1a2

ID
ZDB-MRPHLNO-050316-2
Name
MO1-aldh1a2
Previous Names
  • raldh2 MO
Target
Sequence
5' - GTTCAACTTCACTGGAGGTCATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-aldh1a2
Expressed Gene Anatomy Figures
dlc Fig. 4 from Kawakami et al., 2005
fgf8a Fig. 5 from Kawakami et al., 2005
her1 Fig. 4 with image from Retnoaji et al., 2014
Fig. 4 from Kawakami et al., 2005
her7 Fig. 4 from Kawakami et al., 2005
hoxb1a Fig. 8 with image from Grandel et al., 2002
hoxb1b Fig. 8 with image from Grandel et al., 2002
hoxb4a Fig. 5 with image from Grandel et al., 2002
mafba Fig. 8 with image from Grandel et al., 2002
mespba Fig. 5 from Kawakami et al., 2005
otx2b Fig. 8 with image from Grandel et al., 2002
pax2a Fig. 8 with image from Grandel et al., 2002
pknox1.1 Fig. 4 with image from Vaccari et al., 2010
pknox1.2 Fig. 4 with image from Vaccari et al., 2010
ripply1 Fig. 4 with image from Retnoaji et al., 2014
uncx4.1 Fig. 2 with image from Retnoaji et al., 2014
Fig. 3 from Kawakami et al., 2005
Phenotype
Phenotype resulting from MO1-aldh1a2
Phenotype Fish Figures
cornea increased thickness, abnormal WT + MO1-aldh1a2 + MO4-tp53 Fig. 8 from Bohnsack et al., 2012
corneal endothelium absent, abnormal WT + MO1-aldh1a2 + MO4-tp53 Fig. 8 from Bohnsack et al., 2012
corneal epithelium scalloped, abnormal WT + MO1-aldh1a2 + MO4-tp53 Fig. 8 from Bohnsack et al., 2012
head anterior-posterior axis decreased length, abnormal WT + MO1-aldh1a2 + MO4-tp53 Fig. 8 from Bohnsack et al., 2012
lens decreased size, abnormal WT + MO1-aldh1a2 + MO4-tp53 Fig. 8 from Bohnsack et al., 2012
lens morphology, abnormal WT + MO1-aldh1a2 + MO4-tp53 Fig. 8 from Bohnsack et al., 2012
mandibular arch skeleton malformed, abnormal WT + MO1-aldh1a2 + MO4-tp53 Fig. 8 from Bohnsack et al., 2012
medial rectus myofibril disorganized, abnormal WT + MO1-aldh1a2 + MO4-tp53 Fig. 8 from Bohnsack et al., 2012
pectoral fin absent, abnormal WT + MO1-aldh1a2 + MO4-tp53 Fig. 8 from Bohnsack et al., 2012
pharyngeal arch 3-7 physical object quality, abnormal WT + MO1-aldh1a2 Fig. 4 with image from Vaccari et al., 2010
photoreceptor outer segment layer absent, abnormal WT + MO1-aldh1a2 + MO4-tp53 Fig. 8 from Bohnsack et al., 2012
retinal outer plexiform layer disorganized, abnormal WT + MO1-aldh1a2 + MO4-tp53 Fig. 8 from Bohnsack et al., 2012
retinoic acid receptor signaling pathway process quality, abnormal WT + MO1-aldh1a2 Fig. 4 with image from Vaccari et al., 2010
somite decreased amount, abnormal WT + MO1-aldh1a2 Fig. 2 with image from Retnoaji et al., 2014
somite 4 somitogenesis increased duration, abnormal WT + MO1-aldh1a2 Fig. 1 with image from Retnoaji et al., 2014
vertebra 2 absent, abnormal WT + MO1-aldh1a2 Fig. 2 with image from Retnoaji et al., 2014
Phenotype of all Fish created by or utilizing MO1-aldh1a2
Phenotype Fish Conditions Figures
retinoic acid receptor signaling pathway process quality, abnormal WT + MO1-aldh1a2 standard conditions Fig. 4 with image from Vaccari et al., 2010
pharyngeal arch 3-7 physical object quality, abnormal WT + MO1-aldh1a2 standard conditions Fig. 4 with image from Vaccari et al., 2010
somite decreased amount, abnormal WT + MO1-aldh1a2 standard conditions Fig. 2 with image from Retnoaji et al., 2014
vertebra 2 absent, abnormal WT + MO1-aldh1a2 standard conditions Fig. 2 with image from Retnoaji et al., 2014
somite 4 somitogenesis increased duration, abnormal WT + MO1-aldh1a2 standard conditions Fig. 1 with image from Retnoaji et al., 2014
rhombomere 5 decreased distance somite 1, abnormal WT + MO1-aldh1a2 + MO2-aldh1a2 standard conditions Fig. 3 with image from Begemann et al., 2001
paraxial mesoderm development decreased process quality, abnormal WT + MO1-aldh1a2 + MO2-aldh1a2 standard conditions Fig. 3 with image from Begemann et al., 2001
mandibular arch skeleton malformed, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
cornea increased thickness, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
corneal epithelium scalloped, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
photoreceptor outer segment layer absent, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
pectoral fin absent, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
corneal endothelium absent, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
medial rectus myofibril disorganized, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
retinal outer plexiform layer disorganized, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
head anterior-posterior axis decreased length, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
lens morphology, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
lens decreased size, abnormal WT + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 8 from Bohnsack et al., 2012
mandibular arch skeleton malformed, abnormal mpv17a9/a9; ba2Tg + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 9 from Bohnsack et al., 2012
pharyngeal arch 3-7 skeleton absent, abnormal mpv17a9/a9; ba2Tg + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 9 from Bohnsack et al., 2012
mandibular muscle morphology, abnormal mpv17a9/a9; zf13Tg + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 9 from Bohnsack et al., 2012
branchial muscle malformed, abnormal mpv17a9/a9; zf13Tg + MO1-aldh1a2 + MO4-tp53 standard conditions Fig. 9 from Bohnsack et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.