ZFIN ID: ZDB-MRPHLNO-050209-2
Morpholino Name: MO1-pax2b
Target: pax2b
Sequence:
5' - GGTCTGCCTTACAGTGAATATCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: pax2b MO translation blocker
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pax2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pax2b
Expressed Gene Anatomy Figures
pax8 Fig. S1 with image from Batista et al., 2008
six1b Fig. 11 from Bricaud et al., 2006
PHENOTYPE
Phenotype resulting from MO1-pax2b
No data available

Phenotype of all Fish created by or utilizing MO1-pax2b
Phenotype Fish Conditions Figures
otic vesicle lacks all parts of type otolith, abnormal WT + MO1-pax2b + MO6-pax8 + MO7-pax8 standard conditions Fig. 5 with image from Mackereth et al., 2005
otic vesicle decreased size, abnormal WT + MO1-pax2b + MO6-pax8 + MO7-pax8 standard conditions Fig. 5 with image from Mackereth et al., 2005
otic vesicle morphogenesis process quality, abnormal WT + MO1-pax2b + MO6-pax8 + MO7-pax8 standard conditions Fig. 5 with image from Mackereth et al., 2005
otic vesicle development decreased process quality, abnormal pax2atu29a/tu29a + MO1-pax2b + MO6-pax8 + MO7-pax8 standard conditions Fig. 5 with image from Mackereth et al., 2005
whole organism lacks all parts of type otic vesicle, abnormal pax2atu29a/tu29a + MO1-pax2b + MO6-pax8 + MO7-pax8 standard conditions Fig. 5 with image from Mackereth et al., 2005
epibranchial ganglion decreased amount, abnormal pax2atu29a/tu29a + MO1-pax2b + MO6-pax8 + MO7-pax8 standard conditions Fig. 3 with image from Padanad et al., 2011
otic vesicle physical object quality, abnormal pax2atu29a/tu29a + MO1-pax2b + MO6-pax8 + MO7-pax8 standard conditions Fig. 5 with image from Mackereth et al., 2005
OTHER MO1-pax2b MORPHOLINO PAGESNo links to external sites
CITATIONS (7)