header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050204-3
Morpholino Name: MO1-perp
Target: perp
Previous Name: perp-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGGAACATTATGCTTCTGATAGAGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-perp No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-perp
Expressed Gene Anatomy Figures
crybb1 text only from Nowak et al., 2005
foxa3 text only from Nowak et al., 2005
krt4 text only from Nowak et al., 2005
pax2a text only from Nowak et al., 2005
shha text only from Nowak et al., 2005
tbxta text only from Nowak et al., 2005
PHENOTYPE
Phenotype resulting from MO1-perp
Phenotype of all Fish created by or utilizing MO1-perp
Phenotype Fish Conditions Figures
integument epithelial cell circular, abnormal WT + MO1-perp standard conditions Fig. 8 with image from Nowak et al., 2005
notochord epithelial cell circular, abnormal WT + MO1-perp standard conditions Fig. 6 with image from Nowak et al., 2005
ventral fin fold cell circular, abnormal WT + MO1-perp standard conditions Fig. 8 with image from Nowak et al., 2005
notochord apoptotic, abnormal WT + MO1-perp standard conditions Fig. 7 with imageFig. 8 with image from Nowak et al., 2005
post-vent region decreased length, abnormal WT + MO1-perp standard conditions Fig. 6 with image from Nowak et al., 2005
integument apoptotic, abnormal WT + MO1-perp standard conditions Fig. 7 with imageFig. 8 with image from Nowak et al., 2005
pectoral fin decreased length, abnormal WT + MO1-perp standard conditions Fig. 6 with image from Nowak et al., 2005
whole organism decreased length, abnormal WT + MO1-perp standard conditions Fig. 6 with image from Nowak et al., 2005
integument epithelial cell disorganized, abnormal WT + MO1-perp standard conditions Fig. 6 with image from Nowak et al., 2005
trunk integument rough, abnormal WT + MO1-perp standard conditions Fig. 6 with image from Nowak et al., 2005
caudal fin collapsed, abnormal WT + MO1-perp standard conditions Fig. 6 with image from Nowak et al., 2005
notochord degenerate, abnormal WT + MO1-perp standard conditions Fig. 6 with image from Nowak et al., 2005
notochord epithelial cell disorganized, abnormal WT + MO1-perp standard conditions Fig. 6 with image from Nowak et al., 2005
pectoral fin apoptotic, abnormal WT + MO1-perp standard conditions Fig. 7 with image from Nowak et al., 2005
fin epithelial cell disorganized, abnormal WT + MO1-perp standard conditions Fig. 6 with image from Nowak et al., 2005
pectoral fin malformed, abnormal WT + MO1-perp standard conditions Fig. 6 with image from Nowak et al., 2005
OTHER MO1-perp MORPHOLINO PAGESNo links to external sites
CITATIONS (2)