Morpholino

MO1-perp

ID

ZDB-MRPHLNO-050204-3

Name

MO1-perp

Previous Names

perp-MO (1)

Target

perp

Sequence

5' - CGGAACATTATGCTTCTGATAGAGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-perp

Expressed Gene	Anatomy	Figures
crybb1	lens	text only from Nowak et al., 2005
foxa3	liver pancreas	text only from Nowak et al., 2005
krt4	integument	text only from Nowak et al., 2005
pax2a	otic vesicle pronephric duct	text only from Nowak et al., 2005
shha	notochord	text only from Nowak et al., 2005
tbxta	notochord	text only from Nowak et al., 2005

Phenotype

Phenotype resulting from MO1-perp

Phenotype	Fish	Figures
caudal fin collapsed, abnormal	WT + MO1-perp	Fig. 6 from Nowak et al., 2005
fin epithelial cell disorganized, abnormal	WT + MO1-perp	Fig. 6 from Nowak et al., 2005
integument apoptotic, abnormal	WT + MO1-perp	Fig. 7 , Fig. 8 from Nowak et al., 2005
integument epithelial cell circular, abnormal	WT + MO1-perp	Fig. 8 from Nowak et al., 2005
integument epithelial cell disorganized, abnormal	WT + MO1-perp	Fig. 6 from Nowak et al., 2005
notochord apoptotic, abnormal	WT + MO1-perp	Fig. 7 , Fig. 8 from Nowak et al., 2005
notochord degenerate, abnormal	WT + MO1-perp	Fig. 6 from Nowak et al., 2005
notochord epithelial cell circular, abnormal	WT + MO1-perp	Fig. 6 from Nowak et al., 2005
notochord epithelial cell disorganized, abnormal	WT + MO1-perp	Fig. 6 from Nowak et al., 2005
pectoral fin apoptotic, abnormal	WT + MO1-perp	Fig. 7 from Nowak et al., 2005
pectoral fin decreased length, abnormal	WT + MO1-perp	Fig. 6 from Nowak et al., 2005
pectoral fin malformed, abnormal	WT + MO1-perp	Fig. 6 from Nowak et al., 2005
post-vent region decreased length, abnormal	WT + MO1-perp	Fig. 6 from Nowak et al., 2005
trunk integument rough, abnormal	WT + MO1-perp	Fig. 6 from Nowak et al., 2005
ventral fin fold cell circular, abnormal	WT + MO1-perp	Fig. 8 from Nowak et al., 2005
whole organism decreased length, abnormal	WT + MO1-perp	Fig. 6 from Nowak et al., 2005

Phenotype of all Fish created by or utilizing MO1-perp

Phenotype	Fish	Conditions	Figures
integument epithelial cell circular, abnormal	WT + MO1-perp	standard conditions	Fig. 8 from Nowak et al., 2005
notochord epithelial cell circular, abnormal	WT + MO1-perp	standard conditions	Fig. 6 from Nowak et al., 2005
ventral fin fold cell circular, abnormal	WT + MO1-perp	standard conditions	Fig. 8 from Nowak et al., 2005
notochord apoptotic, abnormal	WT + MO1-perp	standard conditions	Fig. 7 , Fig. 8 from Nowak et al., 2005
post-vent region decreased length, abnormal	WT + MO1-perp	standard conditions	Fig. 6 from Nowak et al., 2005
integument apoptotic, abnormal	WT + MO1-perp	standard conditions	Fig. 7 , Fig. 8 from Nowak et al., 2005
pectoral fin decreased length, abnormal	WT + MO1-perp	standard conditions	Fig. 6 from Nowak et al., 2005
whole organism decreased length, abnormal	WT + MO1-perp	standard conditions	Fig. 6 from Nowak et al., 2005
integument epithelial cell disorganized, abnormal	WT + MO1-perp	standard conditions	Fig. 6 from Nowak et al., 2005
trunk integument rough, abnormal	WT + MO1-perp	standard conditions	Fig. 6 from Nowak et al., 2005
caudal fin collapsed, abnormal	WT + MO1-perp	standard conditions	Fig. 6 from Nowak et al., 2005
notochord degenerate, abnormal	WT + MO1-perp	standard conditions	Fig. 6 from Nowak et al., 2005
notochord epithelial cell disorganized, abnormal	WT + MO1-perp	standard conditions	Fig. 6 from Nowak et al., 2005
pectoral fin apoptotic, abnormal	WT + MO1-perp	standard conditions	Fig. 7 from Nowak et al., 2005
fin epithelial cell disorganized, abnormal	WT + MO1-perp	standard conditions	Fig. 6 from Nowak et al., 2005
pectoral fin malformed, abnormal	WT + MO1-perp	standard conditions	Fig. 6 from Nowak et al., 2005

Citations