Morpholino

MO1-clocka

ID
ZDB-MRPHLNO-050119-1
Name
MO1-clocka
Previous Names
  • clock MO
Target
Sequence
5' - CATCCCGGTCTATGCTGGAGGTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-clocka
Phenotype
Phenotype resulting from MO1-clocka
Phenotype Fish Figures
angioblastic mesenchymal cell lmo2 expression decreased amount, abnormal AB + MO1-clocka Fig. 3 from Bian et al., 2017
angioblastic mesenchymal cell tal1 expression decreased amount, abnormal AB + MO1-clocka Fig. 3 from Bian et al., 2017
angioblastic mesenchymal cell fli1 expression decreased amount, abnormal AB + MO1-clocka Fig. 3 from Bian et al., 2017
axial mesoderm gsc expression decreased amount, abnormal AB + MO1-clocka Fig. 3 from Bian et al., 2017
axial mesoderm tbxta expression decreased amount, abnormal AB + MO1-clocka Fig. 3 from Bian et al., 2017
circadian regulation of gene expression process quality, abnormal AB + MO1-clocka Fig. 5 from Li et al., 2013
circadian regulation of gene expression rhythm quality, abnormal AB + MO1-clocka Fig. 5 from Li et al., 2013
melanin biosynthetic process rhythm quality, abnormal AB + MO1-clocka Fig. 6 with image from Li et al., 2013
nucleate erythrocyte decreased amount, abnormal AB + MO1-clocka Fig. 3 from Bian et al., 2017
pericardium edematous, abnormal AB + MO1-clocka Fig. 2 from Bian et al., 2017
presumptive mesoderm lft1 expression decreased amount, abnormal AB + MO1-clocka Fig. 4 from Bian et al., 2017
presumptive mesoderm eve1 expression decreased amount, abnormal AB + MO1-clocka Fig. 3 from Bian et al., 2017
presumptive mesoderm tbxta expression decreased amount, abnormal AB + MO1-clocka Fig. 3 from Bian et al., 2017
shield gsc expression decreased amount, abnormal AB + MO1-clocka Fig. 3 from Bian et al., 2017
ventral fin fold aplastic, abnormal AB + MO1-clocka Fig. 2 from Bian et al., 2017
ventral mesoderm eve1 expression decreased amount, abnormal AB + MO1-clocka Fig. 3 from Bian et al., 2017
whole organism per3 expression decreased amount, abnormal AB + MO1-clocka Fig. 5 from Li et al., 2013
whole organism smad3a expression decreased amount, abnormal AB + MO1-clocka Fig. 4 from Bian et al., 2017
Fig. 5 from Li et al., 2013
whole organism smad2 expression decreased amount, abnormal AB + MO1-clocka Fig. 4 from Bian et al., 2017
whole organism clocka expression decreased amount, abnormal AB + MO1-clocka Fig. 2Fig. 4 from Bian et al., 2017
whole organism ab4-smad labeling decreased amount, abnormal AB + MO1-clocka Fig. 4 from Bian et al., 2017
whole organism ab1-smad4 labeling decreased amount, abnormal AB + MO1-clocka Fig. 4 from Bian et al., 2017
whole organism mafa expression decreased amount, abnormal AB + MO1-clocka Fig. 5 from Li et al., 2013
whole organism ab-smad2 labeling decreased amount, abnormal AB + MO1-clocka Fig. 4 from Bian et al., 2017
whole organism ppargc1b expression decreased amount, abnormal AB + MO1-clocka Fig. 5 from Li et al., 2013
whole organism ndr2 expression decreased amount, abnormal AB + MO1-clocka Fig. 4 from Bian et al., 2017
whole organism bhlhe41 expression decreased amount, abnormal AB + MO1-clocka Fig. 5 from Li et al., 2013
whole organism bhlhe40 expression decreased amount, abnormal AB + MO1-clocka Fig. 5 from Li et al., 2013
whole organism hnf1a expression decreased amount, abnormal AB + MO1-clocka Fig. 5 from Li et al., 2013
whole organism smad4a expression decreased amount, abnormal AB + MO1-clocka Fig. 4 from Bian et al., 2017
whole organism ab2-smad3 labeling decreased amount, abnormal AB + MO1-clocka Fig. 4 from Bian et al., 2017
whole organism mef2aa expression decreased amount, abnormal AB + MO1-clocka Fig. 5 from Li et al., 2013
whole organism decreased length, abnormal AB + MO1-clocka Fig. 2 from Bian et al., 2017
whole organism clockb expression increased amount, abnormal AB + MO1-clocka Fig. S3 from Bian et al., 2017
whole organism npas2 expression increased amount, abnormal AB + MO1-clocka Fig. S3 from Bian et al., 2017
whole organism smad1 expression increased amount, abnormal AB + MO1-clocka Fig. 5 from Li et al., 2013
whole organism myog expression increased amount, abnormal AB + MO1-clocka Fig. 5 from Li et al., 2013
Phenotype of all Fish created by or utilizing MO1-clocka
Phenotype Fish Conditions Figures
axial mesoderm gsc expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 3 from Bian et al., 2017
whole organism clocka expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 2Fig. 4 from Bian et al., 2017
whole organism ab4-smad labeling decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 4 from Bian et al., 2017
whole organism bhlhe40 expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 5 from Li et al., 2013
presumptive mesoderm eve1 expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 3 from Bian et al., 2017
whole organism hnf1a expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 5 from Li et al., 2013
whole organism smad1 expression increased amount, abnormal AB + MO1-clocka standard conditions Fig. 5 from Li et al., 2013
shield gsc expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 3 from Bian et al., 2017
whole organism per3 expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 5 from Li et al., 2013
whole organism ab-smad2 labeling decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 4 from Bian et al., 2017
whole organism bhlhe41 expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 5 from Li et al., 2013
angioblastic mesenchymal cell fli1 expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 3 from Bian et al., 2017
whole organism npas2 expression increased amount, abnormal AB + MO1-clocka standard conditions Fig. S3 from Bian et al., 2017
whole organism ab1-smad4 labeling decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 4 from Bian et al., 2017
whole organism ab2-smad3 labeling decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 4 from Bian et al., 2017
pericardium edematous, abnormal AB + MO1-clocka standard conditions Fig. 2 from Bian et al., 2017
whole organism ndr2 expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 4 from Bian et al., 2017
circadian regulation of gene expression rhythm quality, abnormal AB + MO1-clocka standard conditions Fig. 5 from Li et al., 2013
whole organism smad2 expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 4 from Bian et al., 2017
whole organism ppargc1b expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 5 from Li et al., 2013
ventral mesoderm eve1 expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 3 from Bian et al., 2017
axial mesoderm tbxta expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 3 from Bian et al., 2017
circadian regulation of gene expression process quality, abnormal AB + MO1-clocka standard conditions Fig. 5 from Li et al., 2013
whole organism mafa expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 5 from Li et al., 2013
whole organism myog expression increased amount, abnormal AB + MO1-clocka standard conditions Fig. 5 from Li et al., 2013
whole organism mef2aa expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 5 from Li et al., 2013
angioblastic mesenchymal cell lmo2 expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 3 from Bian et al., 2017
whole organism decreased length, abnormal AB + MO1-clocka standard conditions Fig. 2 from Bian et al., 2017
melanin biosynthetic process rhythm quality, abnormal AB + MO1-clocka standard conditions Fig. 6 with image from Li et al., 2013
nucleate erythrocyte decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 3 from Bian et al., 2017
presumptive mesoderm lft1 expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 4 from Bian et al., 2017
angioblastic mesenchymal cell tal1 expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 3 from Bian et al., 2017
ventral fin fold aplastic, abnormal AB + MO1-clocka standard conditions Fig. 2 from Bian et al., 2017
whole organism smad3a expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 4 from Bian et al., 2017
Fig. 5 from Li et al., 2013
whole organism clockb expression increased amount, abnormal AB + MO1-clocka standard conditions Fig. S3 from Bian et al., 2017
presumptive mesoderm tbxta expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 3 from Bian et al., 2017
whole organism smad4a expression decreased amount, abnormal AB + MO1-clocka standard conditions Fig. 4 from Bian et al., 2017
circadian regulation of gene expression disrupted, abnormal WT + MO1-clocka lighting conditions Fig. 3 from Li et al., 2008
Citations