header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-041207-4
Morpholino Name: MO1-notch1a
Target: notch1a (1)
Previous Name: MO-notch1a-1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAAACGGTTCATAACTCCGCCTCGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: designed to bind to 5'-end of gene
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-notch1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-notch1a No data available
PHENOTYPE
Phenotype resulting from MO1-notch1a
Phenotype of all Fish created by or utilizing MO1-notch1a
Phenotype Fish Conditions Figures
choroid plexus fourth ventricle shape, abnormal mn16Et + MO1-notch1a standard conditions Fig. 5 with image from Bill et al., 2008
whole organism runx1 expression amount, ameliorated TU + MO1-mettl3 + MO1-notch1a standard conditions Fig. 3 from Zhang et al., 2017
retinal cone cell amount, ameliorated WT + MO1-id2a + MO1-notch1a control Fig. 5 with image from Uribe et al., 2012
retina cell population proliferation process quality, ameliorated WT + MO1-id2a + MO1-notch1a standard conditions Fig. 4 with image from Uribe et al., 2012
eye cell amount, ameliorated WT + MO1-id2a + MO1-notch1a standard conditions Fig. 4 with image from Uribe et al., 2012
amacrine cell amount, ameliorated WT + MO1-id2a + MO1-notch1a control Fig. 5 with image from Uribe et al., 2012
camera-type eye photoreceptor cell differentiation process quality, ameliorated WT + MO1-id2a + MO1-notch1a control Fig. 5 with image from Uribe et al., 2012
neural plate morphology, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 1 from Yeo et al., 2007
negative regulation of neurogenesis decreased occurrence, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
Notch signaling pathway decreased occurrence, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
central nervous system cellular quality, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Yeo et al., 2007
neural plate development process quality, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 1 from Yeo et al., 2007
neurogenesis increased occurrence, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
negative regulation of neurogenesis decreased occurrence, abnormal WT + MO1-nlk1 + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
Notch signaling pathway decreased occurrence, abnormal WT + MO1-nlk1 + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
neurogenesis increased occurrence, abnormal WT + MO1-nlk1 + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
peripheral neuron decreased length, abnormal knu2Tg + MO1-notch1a + MO1-notch3 + MO4-notch1b standard conditions Fig. 4 from So et al., 2009
OTHER MO1-notch1a MORPHOLINO PAGESNo links to external sites
CITATIONS (14)