ZFIN ID: ZDB-MRPHLNO-041207-3
Morpholino Name: MO1-jag1b
Target: jag1b (1)
Previous Names: J1bATG-MO (1), jagged1b-MO (1), MO-jag1b-1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTGAACTCCGTCGCAGAATCATGCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: designed to bind to 5'-end of gene
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-jag1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-jag1b No data available
PHENOTYPE
Phenotype resulting from MO1-jag1b
No data available

Phenotype of all Fish created by or utilizing MO1-jag1b
Genome Resources:
CITATIONS (13)