header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-041109-4
Morpholino Name: MO1-fgf3
Target: fgf3 (1)
Previous Names: fgf3-MO #1, fgf3A-MO

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CATTGTGGCATGGCGGGATGTCGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-fgf3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-fgf3
Expressed Gene Anatomy Figures
dlx2a Fig. 4 with image from Walshe et al., 2003
etv4 Fig. 3 from Lin et al., 2013
etv5b Fig. 3 from Lin et al., 2013
Fig. 4 with image from Walshe et al., 2003
fgf3 Fig. 4 with image from Walshe et al., 2003
fgf22 Fig. 8 with image from Miyake et al., 2013
gcm2 Fig. 4 from Hanaoka et al., 2004
gh1 Fig. 3 with image from Liu et al., 2008
lhx3 Fig. 6 with image from Liu et al., 2008
pomca Fig. 3 with image from Liu et al., 2008
pou1f1 Fig. 3 with image from Liu et al., 2008
prl Fig. 3 with image from Liu et al., 2008
PHENOTYPE
Phenotype resulting from MO1-fgf3
Phenotype of all Fish created by or utilizing MO1-fgf3
Phenotype Fish Conditions Figures
pharyngeal arch 4 has fewer parts of type cranial neural crest, abnormal AB + MO1-fgf3 standard conditions Fig. 3 from Lin et al., 2013
pharyngeal arch 3-7 skeleton absent, abnormal AB + MO1-fgf3 standard conditions Fig. 3 from Lin et al., 2013
ceratobranchial cartilage absent, abnormal AB + MO1-fgf3 standard conditions Fig. 3 from Lin et al., 2013
ceratohyal cartilage malformed, abnormal AB + MO1-fgf3 standard conditions Fig. 3 from Lin et al., 2013
ceratohyal cartilage aplastic, abnormal WT + MO1-fgf3 standard conditions Fig. 4 from Hanaoka et al., 2004
basibranchial aplastic, abnormal WT + MO1-fgf3 standard conditions Fig. 4 from Hanaoka et al., 2004
hyosymplectic cartilage hypoplastic, abnormal WT + MO1-fgf3 standard conditions Fig. 8 with image from Nissen et al., 2003
otic vesicle decreased size, abnormal WT + MO1-fgf3 + MO2-fgf3 standard conditions Fig. 4 with image from Mackereth et al., 2005
otic vesicle morphogenesis process quality, abnormal WT + MO1-fgf3 + MO2-fgf3 standard conditions Fig. 4 with image from Mackereth et al., 2005
adenohypophysis morphogenesis process quality, abnormal zf44Tg + MO1-fgf3 standard conditions Fig. 2 with imageFig. 3 with imageFig. 5 with image from Liu et al., 2008
pars intermedia physical object quality, abnormal zf44Tg + MO1-fgf3 standard conditions Fig. 2 with imageFig. 3 with imageFig. 5 with image from Liu et al., 2008
adenohypophysis morphogenesis process quality, abnormal zf113Tg; zf44Tg + MO1-fgf3 standard conditions Fig. 4 with image from Liu et al., 2008
pars intermedia physical object quality, abnormal zf113Tg; zf44Tg + MO1-fgf3 standard conditions Fig. 4 with image from Liu et al., 2008
otic vesicle decreased size, abnormal WT + MO1-fgf3 + MO2-fgf3 + MO6-pax8 + MO7-pax8 standard conditions Fig. 4 with image from Mackereth et al., 2005
otic vesicle morphogenesis process quality, abnormal WT + MO1-fgf3 + MO2-fgf3 + MO6-pax8 + MO7-pax8 standard conditions Fig. 4 with image from Mackereth et al., 2005
otic placode physical object quality, abnormal WT + MO1-fgf3 + MO2-fgf3 + MO6-pax8 + MO7-pax8 standard conditions Fig. 4 with image from Mackereth et al., 2005
midbrain development disrupted, abnormal WT + MO1-fgf3 + MO3-fgf8a standard conditions Fig. 9 with image from Miyake et al., 2014
OTHER MO1-fgf3 MORPHOLINO PAGES No links to external sites
CITATIONS (27)