Morpholino

MO1-fgf3

ID

ZDB-MRPHLNO-041109-4

Name

MO1-fgf3

Previous Names

fgf3-MO #1
fgf3A-MO

Target

fgf3 (1)

Sequence

5' - CATTGTGGCATGGCGGGATGTCGGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-fgf3

Expressed Gene	Anatomy	Figures
dlx2a	(not) mandibular arch skeleton pharyngeal arch 2 skeleton (not) pharyngeal arch 3 skeleton	Fig. 4 from Walshe et al., 2003
etv4	pharyngeal arch 2 cranial neural crest pharyngeal arch 3 cranial neural crest	Fig. 3 from Lin et al., 2013
etv5b	midbrain hindbrain boundary pharyngeal arch 1 cranial neural crest pharyngeal arch 2 cranial neural crest pharyngeal arch 2 skeleton pharyngeal arch 3 cranial neural crest (not) pharyngeal arch 3 skeleton	Fig. 3 from Lin et al., 2013 Fig. 4 from Walshe et al., 2003
fgf3	midbrain hindbrain boundary pharyngeal pouch 1 rhombomere 4	Fig. 4 from Walshe et al., 2003
fgf22	midbrain posterior region	Fig. 8 from Miyake et al., 2013
gcm2	(not) ectoderm (not) pharyngeal arch	Fig. 4 from Hanaoka et al., 2004
gh1	adenohypophyseal placode	Fig. 3 from Liu et al., 2008
lhx3	adenohypophyseal placode	Fig. 6 from Liu et al., 2008
pax2a	epibranchial field midbrain hindbrain boundary neural rod	Fig. 5 from Sun et al., 2007
pomca	hypothalamus pars anterior (not) pars intermedia	Fig. 3 from Liu et al., 2008
pou1f1	adenohypophyseal placode	Fig. 3 from Liu et al., 2008
prl	adenohypophyseal placode	Fig. 3 from Liu et al., 2008
sox3	epibranchial field	Fig. 5 from Sun et al., 2007

Phenotype

Phenotype resulting from MO1-fgf3

Phenotype	Fish	Figures
adenohypophysis morphogenesis process quality, abnormal	zf113Tg; zf44Tg + MO1-fgf3	Fig. 2 , Fig. 3 , Fig. 4 , Fig. 5 from Liu et al., 2008
basibranchial aplastic, abnormal	WT + MO1-fgf3	Fig. 4 from Hanaoka et al., 2004
ceratobranchial cartilage absent, abnormal	AB + MO1-fgf3	Fig. 3 from Lin et al., 2013
ceratohyal cartilage aplastic, abnormal	WT + MO1-fgf3	Fig. 4 from Hanaoka et al., 2004
ceratohyal cartilage malformed, abnormal	AB + MO1-fgf3	Fig. 3 from Lin et al., 2013
epibranchial field sox3 expression decreased amount, abnormal	WT + MO1-fgf3	Fig. 5 from Sun et al., 2007
epibranchial field pax2a expression decreased amount, abnormal	WT + MO1-fgf3	Fig. 5 from Sun et al., 2007
hyosymplectic cartilage hypoplastic, abnormal	WT + MO1-fgf3	Fig. 8 from Nissen et al., 2003
pars intermedia physical object quality, abnormal	zf44Tg + MO1-fgf3	Fig. 2 , Fig. 3 , Fig. 4 , Fig. 5 from Liu et al., 2008
pharyngeal arch 3-7 skeleton absent, abnormal	AB + MO1-fgf3	Fig. 3 from Lin et al., 2013
pharyngeal arch 4 has fewer parts of type cranial neural crest, abnormal	AB + MO1-fgf3	Fig. 3 from Lin et al., 2013

Phenotype of all Fish created by or utilizing MO1-fgf3

Phenotype	Fish	Conditions	Figures
pharyngeal arch 4 has fewer parts of type cranial neural crest, abnormal	AB + MO1-fgf3	standard conditions	Fig. 3 from Lin et al., 2013
pharyngeal arch 3-7 skeleton absent, abnormal	AB + MO1-fgf3	standard conditions	Fig. 3 from Lin et al., 2013
ceratobranchial cartilage absent, abnormal	AB + MO1-fgf3	standard conditions	Fig. 3 from Lin et al., 2013
ceratohyal cartilage malformed, abnormal	AB + MO1-fgf3	standard conditions	Fig. 3 from Lin et al., 2013
epibranchial field sox3 expression decreased amount, abnormal	WT + MO1-fgf3	standard conditions	Fig. 5 from Sun et al., 2007
ceratohyal cartilage aplastic, abnormal	WT + MO1-fgf3	standard conditions	Fig. 4 from Hanaoka et al., 2004
epibranchial field pax2a expression decreased amount, abnormal	WT + MO1-fgf3	standard conditions	Fig. 5 from Sun et al., 2007
basibranchial aplastic, abnormal	WT + MO1-fgf3	standard conditions	Fig. 4 from Hanaoka et al., 2004
hyosymplectic cartilage hypoplastic, abnormal	WT + MO1-fgf3	standard conditions	Fig. 8 from Nissen et al., 2003
otic vesicle decreased size, abnormal	WT + MO1-fgf3 + MO2-fgf3	standard conditions	Fig. 4 from Mackereth et al., 2005
otic vesicle morphogenesis process quality, abnormal	WT + MO1-fgf3 + MO2-fgf3	standard conditions	Fig. 4 from Mackereth et al., 2005
adenohypophysis morphogenesis process quality, abnormal	zf44Tg + MO1-fgf3	standard conditions	Fig. 2 , Fig. 3 , Fig. 5 from Liu et al., 2008
pars intermedia physical object quality, abnormal	zf44Tg + MO1-fgf3	standard conditions	Fig. 2 , Fig. 3 , Fig. 5 from Liu et al., 2008
adenohypophysis morphogenesis process quality, abnormal	zf113Tg; zf44Tg + MO1-fgf3	standard conditions	Fig. 4 from Liu et al., 2008
pars intermedia physical object quality, abnormal	zf113Tg; zf44Tg + MO1-fgf3	standard conditions	Fig. 4 from Liu et al., 2008
epibranchial field pax2a expression absent, abnormal	fgf8a^{ti282a/ti282a} + MO1-fgf3	standard conditions	Fig. 5 from Sun et al., 2007
midbrain hindbrain boundary neural rod pax2a expression absent, abnormal	fgf8a^{ti282a/ti282a} + MO1-fgf3	standard conditions	Fig. 5 from Sun et al., 2007
epibranchial field sox3 expression decreased amount, abnormal	fgf8a^{ti282a/ti282a} + MO1-fgf3	standard conditions	Fig. 5 from Sun et al., 2007
otic vesicle decreased size, abnormal	WT + MO1-fgf3 + MO2-fgf3 + MO6-pax8 + MO7-pax8	standard conditions	Fig. 4 from Mackereth et al., 2005
otic vesicle morphogenesis process quality, abnormal	WT + MO1-fgf3 + MO2-fgf3 + MO6-pax8 + MO7-pax8	standard conditions	Fig. 4 from Mackereth et al., 2005
otic placode physical object quality, abnormal	WT + MO1-fgf3 + MO2-fgf3 + MO6-pax8 + MO7-pax8	standard conditions	Fig. 4 from Mackereth et al., 2005
epibranchial field pax2a expression absent, abnormal	WT + MO1-fgf3 + MO3-fgf8a	standard conditions	Fig. 5 from Sun et al., 2007
midbrain development disrupted, abnormal	WT + MO1-fgf3 + MO3-fgf8a	standard conditions	Fig. 9 from Miyake et al., 2014
epibranchial field sox3 expression absent, abnormal	WT + MO1-fgf3 + MO3-fgf8a	standard conditions	Fig. 5 from Sun et al., 2007

Citations