CRISPR

CRISPR1-rbm8a

ID
ZDB-CRISPR-210208-1
Name
CRISPR1-rbm8a
Previous Names
None
Target
Sequence
5' - GGGAGGCGAAGACTTTCCTA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
oz36 rbm8a
Expression
Gene expression in Wild Types + CRISPR1-rbm8a
No data available
Phenotype
Phenotype resulting from CRISPR1-rbm8a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-rbm8a
Phenotype Fish Conditions Figures
myotome U-shaped, abnormal rbm8aoz36/oz36 standard conditions Fig 3 with image from Gangras et al., 2020
muscle cell disorganized, abnormal rbm8aoz36/oz36 standard conditions Fig 3 with image from Gangras et al., 2020
whole organism rbm8a expression decreased amount, abnormal rbm8aoz36/oz36 standard conditions Fig 2 with image from Gangras et al., 2020
motor neuron axon decreased length, abnormal rbm8aoz36/oz36 standard conditions Fig 3 with image from Gangras et al., 2020
trunk curved ventral, abnormal rbm8aoz36/oz36 standard conditions Fig 2 with imagetext only from Gangras et al., 2020
whole organism gtpbp1l expression increased amount, abnormal rbm8aoz36/oz36 standard conditions Fig 5 with image from Gangras et al., 2020
whole organism gadd45aa expression increased amount, abnormal rbm8aoz36/oz36 standard conditions Fig 5 with image from Gangras et al., 2020
head necrotic, abnormal rbm8aoz36/oz36 standard conditions Fig 2 with image from Gangras et al., 2020
whole organism srsf7a expression increased amount, abnormal rbm8aoz36/oz36 standard conditions Fig 5 with image from Gangras et al., 2020
whole organism atxn1b expression increased amount, abnormal rbm8aoz36/oz36 standard conditions Fig 5 with image from Gangras et al., 2020
whole organism dead, abnormal rbm8aoz36/oz36 standard conditions text only from Gangras et al., 2020
whole organism eif4a3 expression decreased amount, abnormal rbm8aoz36/oz36 standard conditions Fig 2 with image from Gangras et al., 2020
whole organism paralysed, abnormal rbm8aoz36/oz36 standard conditions Fig 3 with image from Gangras et al., 2020
whole organism neuromuscular junction decreased amount, abnormal rbm8aoz36/oz36 standard conditions Fig 3 with image from Gangras et al., 2020
whole organism magoh expression decreased amount, abnormal rbm8aoz36/oz36 standard conditions Fig 2 with image from Gangras et al., 2020
whole organism necrotic, abnormal rbm8aoz36/oz36 standard conditions text only from Gangras et al., 2020
muscle contraction decreased occurrence, abnormal rbm8aoz36/oz36 standard conditions Fig 3 with image from Gangras et al., 2020
heart edematous, abnormal rbm8aoz36/oz36 standard conditions text only from Gangras et al., 2020
whole organism eif4a2 expression increased amount, abnormal rbm8aoz36/oz36 standard conditions Fig 5 with image from Gangras et al., 2020
whole organism srsf3a expression increased amount, abnormal rbm8aoz36/oz36 standard conditions Fig 5 with image from Gangras et al., 2020
Citations