ZFIN ID: ZDB-CRISPR-191213-3
CRISPR Name: CRISPR3-taf1
Target: taf1 (1)
Source:
Target Sequence:
5' - GGTGTCCCGGAGGATGGCAGCGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR3-taf1 No data available
GENOMIC FEATURES CREATED WITH CRISPR3-taf1
Genomic Feature Affected Genomic Regions    
uu1941 taf1    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR3-taf1 No data available
PHENOTYPE
Phenotype resulting from CRISPR3-taf1
No data available

Phenotype of all Fish created by or utilizing CRISPR3-taf1
Phenotype Fish Conditions Figures
pectoral fin shortened, abnormal taf1uu1941/uu1941(AB) standard conditions Fig. 3 with imageFig. S2 with image from Gudmundsson et al., 2019
cranial cartilage immature, abnormal taf1uu1941/uu1941(AB) standard conditions Fig. S2 with imageFig. S3 from Gudmundsson et al., 2019
optic tectum decreased size, abnormal taf1uu1941/uu1941(AB) standard conditions Fig. 3 with image from Gudmundsson et al., 2019
whole organism decreased size, abnormal taf1uu1941/uu1941(AB) standard conditions Fig. 3 with image from Gudmundsson et al., 2019
whole organism anterior-posterior axis bent, abnormal taf1uu1941/uu1941(AB) standard conditions Fig. 3 with imageFig. S2 with image from Gudmundsson et al., 2019
eye decreased size, abnormal taf1uu1941/uu1941(AB) standard conditions Fig. 3 with imageFig. S2 with image from Gudmundsson et al., 2019
cartilage tissue decreased size, abnormal taf1uu1941/uu1941(AB) standard conditions Fig. 3 with image from Gudmundsson et al., 2019
blood accumulation coelom, abnormal taf1uu1941/uu1941(AB) standard conditions Fig. 3 with imageFig. S2 with image from Gudmundsson et al., 2019
inner ear malformed, abnormal taf1uu1941/uu1941(AB) standard conditions Fig. S2 with image from Gudmundsson et al., 2019
brain edematous, abnormal taf1uu1941/uu1941(AB) standard conditions Fig. S2 with image from Gudmundsson et al., 2019
whole organism dead, abnormal taf1uu1941/uu1941(AB) standard conditions Fig. S3 from Gudmundsson et al., 2019
heart contraction arrested, abnormal taf1uu1941/uu1941(AB) standard conditions Fig. S3 from Gudmundsson et al., 2019
inner ear decreased size, abnormal taf1uu1941/uu1941(AB) standard conditions Fig. 3 with imageFig. S2 with image from Gudmundsson et al., 2019
whole organism decreased pigmentation, abnormal taf1uu1941/uu1941(AB) standard conditions Fig. S2 with image from Gudmundsson et al., 2019
heart edematous, abnormal taf1uu1941/uu1941(AB) standard conditions Fig. 3 with imageFig. S2 with imageFig. S3 from Gudmundsson et al., 2019
embryo development delayed, abnormal taf1uu1941/uu1941(AB) standard conditions Fig. S2 with image from Gudmundsson et al., 2019
Genome Resources:
CITATIONS (1)