ZFIN ID: ZDB-ALT-191213-2
Genomic Feature: uu1941
Synonyms:
Affected Genomic Regions: taf1 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR3-taf1
Lab Of Origin: Uppsala University Zebrafish Facility, Regional SciLifeLab Facility
Location: Chr 5: 36586291 - 36586300 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 10 bp deleted in Exon 8 (1)
Transcript Consequence: Frameshift, Premature Stop (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
AGTGAATGTGCATGCGTGATCTTCTCTGTGCTTGTTGCATCATAGATATTCTCTCACCCTGCTGAGCGTTGTAAGCATTGGCGTTTCGGGTCATGCTAGTAGGCAGCCACCCAGCCAGACTAGCACGCTGAGTTTTAGTGCCCTTGTGTTTTACATCCTCTCCATTCCAGATAATGTCTTCCTCCCACTGCAGTTGGGTCACCATTAAAAACAGCTCATCCTGCATTGGAGCATCCTCATCCGCCTGCAAACACACAAACACAAGTGCACACAATTAAATTGAGTTGTCTCTATTAAAATGTGCTGTACTGGTTATTTATTGCAAATCAAAGTGCAGTAAACAGTGAAACAAACACAACGCTGACCTTATCTTGTGATTCTTGTGGTGGTTCCTGCTCAGGCACTGGTTCAGAAGCTGGAGGAGTTGCCATTTTTGTCACTGCATCAGTGTTGTCTTCCTGTTTGTCATCTTTCAGCTTAAATCCATAATGAAAGCCGCT
GGAGGATGGC/-
GGGACACCAAGCATGTCATACCAAAGCTGTGCTGGACCATAACGCCACTCAGCCACCTTTGGCCTCATCTCAGACACTTTATCACCTTCACCAGACACCTGCATGAACTTAGACTCCACCGGAGCCATCATGGTGATCTACAGAAAACAAGACACACAGAAACAGAGTGTTTTCTTTCTGACACCATCATTTTTTAGGAAGCGTCTAAGTCAGAGGTGTCCAAACTGGGCACTGGAGGGCCGGTGTCCTGCAGATTTTTGCTCCAACTTGCCTCAACACACCTGCAAGGATGTTTCTAGAAAGCCTAGTAAGAGCTTGATTAGCTAGCCCAGGTGTGTCTGATTGGGGTTGGAACTAAACTTTGCAGGACACCGGCCCTCCAGGACCGAGCTTGGACATGCCTGGTCTAAGTGGACATAAAATGCTGACTCAGTTAGGATTACCTCATCATCAGACAGACACTGCTCTGGGGGTGGAGGCGGTGCATACTCATAGTCCCA
Comment Citation
c.1082_1091del, p.Glu-362Alafs*9 Gudmundsson et al., 2019
OTHER uu1941 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous taf1uu1941/uu1941 (AB) taf1 ♀+/- ♂+/-

CITATIONS  (1)