ZFIN ID: ZDB-CRISPR-190108-4
CRISPR Name: CRISPR1-foxf1
Target: foxf1 (1)
Source:
Target Sequence:
5' - GGGACGACGAATTCCAGCGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-foxf1 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-foxf1
Genomic Feature Affected Genomic Regions    
el658 foxf1    
el660 foxf1    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-foxf1 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-foxf1
No data available

Phenotype of all Fish created by or utilizing CRISPR1-foxf1
Phenotype Fish Conditions Figures
intestine decreased size, abnormal foxf1el658/el658 standard conditions Fig. S5 with image from Xu et al., 2018
swim bladder uninflated, abnormal foxf1el658/el658 standard conditions Fig. S5 with image from Xu et al., 2018
basihyal cartilage decreased size, abnormal foxf1el658/el658 ; foxf2ael616/el616 standard conditions Fig. 3 with image from Xu et al., 2018
basibranchial morphology, abnormal foxf1el658/el658 ; foxf2ael616/el616 standard conditions Fig. 3 with image from Xu et al., 2018
ceratohyal cartilage decreased size, abnormal foxf1el658/el658 ; foxf2ael616/el616 ; foxf2bel621/+ standard conditions Fig. 3 with image from Xu et al., 2018
whole organism lacks all parts of type basibranchial, abnormal foxf1el658/el658 ; foxf2ael616/el616 ; foxf2bel621/+ standard conditions Fig. 3 with image from Xu et al., 2018
pterygoid process decreased size, abnormal foxf1el658/el658 ; foxf2ael616/el616 ; foxf2bel621/+ standard conditions Fig. 3 with image from Xu et al., 2018
whole organism lacks all parts of type basihyal cartilage, abnormal foxf1el658/el658 ; foxf2ael616/el616 ; foxf2bel621/+ standard conditions Fig. 3 with image from Xu et al., 2018
whole organism has fewer parts of type ceratobranchial 5 tooth, abnormal foxf1el658/el658 ; foxf2ael616/el616 ; foxf2bel621/+ standard conditions Fig. 3 with image from Xu et al., 2018
pharyngeal arch 1 hand2 expression decreased distribution, abnormal foxf1el658/el658 ; foxf2ael616/el616 ; foxf2bel621/+ standard conditions Fig. 4 with image from Xu et al., 2018
Meckel's cartilage decreased size, abnormal foxf1el658/el658 ; foxf2ael616/el616 ; foxf2bel621/+ standard conditions Fig. 3 with image from Xu et al., 2018
Meckel's cartilage col2a1a expression decreased distribution, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 5 with image from Xu et al., 2018
pharyngeal arch 1 cartilage development decreased occurrence, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
whole organism lacks all parts of type tooth 4V, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
ethmoid cartilage decreased size, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
ceratohyal cartilage decreased size, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
ceratobranchial 5 primary tooth fgf3 expression absent, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
ceratobranchial 5 primary tooth dlx2b expression absent, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
whole organism lacks all parts of type tooth 5V, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
Meckel's cartilage matn4 expression decreased distribution, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 5 with image from Xu et al., 2018
whole organism lacks all parts of type basibranchial, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
neurocranium cartilage development decreased occurrence, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
whole organism lacks all parts of type neurocranial trabecula, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
whole organism lacks all parts of type tooth 3V, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
Meckel's cartilage matn1 expression decreased distribution, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 5 with image from Xu et al., 2018
whole organism lacks all parts of type basihyal cartilage, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
whole organism has fewer parts of type ceratobranchial 5 tooth, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
Meckel's cartilage decreased size, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
pterygoid process decreased size, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
pharyngeal arch 2 cartilage development decreased occurrence, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
Meckel's cartilage acana expression decreased distribution, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 5 with image from Xu et al., 2018
head decreased size, abnormal foxf2ael616/el616 ; foxf1el658/el658 ; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
Genome Resources:
CITATIONS (1)