header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-180919-2
CRISPR Name: CRISPR1-epas1a
Target: epas1a (1)
Source:
Target Sequence:
5' - CAAAAATGGAGGCTACGTTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-epas1a No data available
GENOMIC FEATURES CREATED WITH CRISPR1-epas1a
Genomic Feature Affected Genomic Regions    
bns231 epas1a    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-epas1a No data available
PHENOTYPE
Phenotype resulting from CRISPR1-epas1a
No data available

Phenotype of all Fish created by or utilizing CRISPR1-epas1a
Phenotype Fish Conditions Figures
whole organism runx1 expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 4 from Gerri et al., 2018
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 1 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 1 from Gerri et al., 2018
whole organism gata2b expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 control Fig. 5 from Gerri et al., 2018
hematopoietic progenitor cell differentiation decreased occurrence, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 1 from Gerri et al., 2018
whole organism notch1a expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 control Fig. 5 from Gerri et al., 2018
whole organism notch1b expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 control Fig. 5 from Gerri et al., 2018
hematopoietic system myb expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 1 from Gerri et al., 2018
hematopoietic system runx1 expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 1 from Gerri et al., 2018
whole organism myb expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 4 from Gerri et al., 2018
hemopoiesis decreased occurrence, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 1 from Gerri et al., 2018
OTHER CRISPR1-epas1a CRISPR PAGES No links to external sites
CITATIONS (1)