header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-170222-1
CRISPR Name: CRISPR2-wnt9a
Target: wnt9a (1)
Source:
Target Sequence:
5' - TGTCCATTCTGCCACTGACC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR2-wnt9a No data available
GENOMIC FEATURES CREATED WITH CRISPR2-wnt9a
Genomic Feature Affected Genomic Regions    
zf754 wnt9a    
zf758 wnt9a    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR2-wnt9a No data available
PHENOTYPE
Phenotype resulting from CRISPR2-wnt9a
No data available

Phenotype of all Fish created by or utilizing CRISPR2-wnt9a
Phenotype Fish Conditions Figures
interhyal cartilage chondrocyte decreased amount, abnormal wnt9azf754/zf754 standard conditions Fig. 5 with image from Ling et al., 2017
Meckel's cartilage shortened, abnormal wnt9azf754/zf754 standard conditions Fig. 2 with image from Ling et al., 2017
quadrate-anguloarticular joint morphology, abnormal wnt9azf754/zf754 standard conditions Fig. 5 with image from Ling et al., 2017
palate chondrocyte size, abnormal wnt9azf758/zf758 standard conditions Fig. 2 with image from Rochard et al., 2016
palate decreased width, abnormal wnt9azf758/zf758 standard conditions Fig. 1 with image from Rochard et al., 2016
palate increased length, abnormal wnt9azf758/zf758 standard conditions Fig. 1 with image from Rochard et al., 2016
ossification process quality, abnormal ir937Tg ; wnt9azf754/zf754 standard conditions Fig. 4 with image from Ling et al., 2017
endochondral bone absent, abnormal ir937Tg ; wnt9azf754/zf754 standard conditions Fig. 4 with image from Ling et al., 2017
Meckel's cartilage chondrocyte positional polarity, abnormal ir937Tg ; wnt9azf754/zf754 standard conditions Fig. 3 with image from Ling et al., 2017
head muscle decreased length, abnormal ir937Tg ; wnt9azf754/zf754 standard conditions Fig. 5 with image from Ling et al., 2017
chondrocyte microtubule organizing center disorganized, abnormal ir937Tg ; wnt9azf754/zf754 standard conditions Fig. 3 with image from Ling et al., 2017
Meckel's cartilage chondrocyte morphology, abnormal ir937Tg ; wnt9azf754/zf754 standard conditions Fig. 3 with image from Ling et al., 2017
ceratobranchial 5 bone absent, abnormal ir937Tg ; wnt9azf754/zf754 standard conditions Fig. 4 with image from Ling et al., 2017
retroarticular absent, abnormal ir937Tg ; wnt9azf754/zf754 standard conditions Fig. 4 with image from Ling et al., 2017
endochondral ossification disrupted, abnormal ir937Tg ; wnt9azf754/zf754 standard conditions Fig. 4 with image from Ling et al., 2017
palate chondrocyte size, abnormal wlszf759/zf759 ; wnt9azf758/zf758 standard conditions Fig. 4 with image from Rochard et al., 2016
palate decreased width, abnormal wlszf759/zf759 ; wnt9azf758/zf758 standard conditions Fig. 4 with image from Rochard et al., 2016
palate chondrocyte irregular spatial pattern, abnormal wlszf759/zf759 ; wnt9azf758/zf758 standard conditions Fig. 4 with image from Rochard et al., 2016
palate chondrocyte size, abnormal wnt9azf758/zf758 ; wnt5bhi2735bTg/hi2735bTg standard conditions Fig. 4 with image from Rochard et al., 2016
palate decreased width, abnormal wnt9azf758/zf758 ; wnt5bhi2735bTg/hi2735bTg standard conditions Fig. 4 with image from Rochard et al., 2016
OTHER CRISPR2-wnt9a CRISPR PAGESNo links to external sites
CITATIONS (2)