ZFIN ID: ZDB-CRISPR-160126-2
CRISPR Name: CRISPR1-junbb
Target: junbb (1)
Source:
Target Sequence:
5' - GGGTTACGGTCACAACGACG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-junbb No data available
GENOMIC FEATURES CREATED WITH CRISPR1-junbb No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-junbb No data available
PHENOTYPE
Phenotype resulting from CRISPR1-junbb
Phenotype of all Fish created by or utilizing CRISPR1-junbb
Genome Resources:
CITATIONS (1)