header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-150819-21
CRISPR Name: CRISPR4-myd88
Target: myd88 (1)
Source:
Target Sequence:
5' - GTATAGTAATGTTACTATTA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR4-myd88 No data available
GENOMIC FEATURES CREATED WITH CRISPR4-myd88 No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR4-myd88 No data available
PHENOTYPE
Phenotype resulting from CRISPR4-myd88
No data available

Phenotype of all Fish created by or utilizing CRISPR4-myd88
OTHER CRISPR4-myd88 CRISPR PAGES No links to external sites
CITATIONS (1)