ZFIN ID: ZDB-ALT-980203-771
Genomic Feature: m477
Synonyms:
Affected Genomic Regions: flr
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Driever Lab
Location: Chr 3: 28837730 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A at position 798 (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Tyr>Stop at position 266 (1)
FLANKING SEQUENCE (GENOMIC)
TTTATGCAGCAGATGCCCTTCCAGCCGTAACCCAATCTCTGGGAAACACCCATACATACTCAATCACACACATACACTACGGCCAATTTAGCTTACCCAATTCACCTATACTGCATGTCTTTGGACTTGTGGGGGAAACCGGAGCACCCGAAGGAAACCCTCACGAACACAGTGAGAACATGCAAACTCCGTACAGAAACGCCAGCTGACCCAGCCGAGGCGATAGTGGTAGTGGGTAGTGCCACCGCTTCACCCTCTTTACAAACATTTTAGAGAATAAGAGATCTGGACTTTCTACAGTGAGACAGAATTTAAAAATATCTCCATTCGTGCTCTGAAGATAAACAAAAGTCTTATAGGTTTGTAATGTATTGAGCATGAGTAAATGATGAACAACCAGAGTCTTTTACTAATTAGATTTCAGTTAGCTAACATAAGTTTTGTAGCACTTATGTAATTAAAAAATGTAATTGAGAAATATATTTAAATCTATTTGCAGA
T/A
GCTGCAGCACAGGAAGCACTGACGGACATGCCTCCCAGATCAGAAGAGGTAATAAAATGTTCACTCCTAAAATGTTACCATTTTTATTCAAATGTGTTTTTAATTTATTCATTTTTTATAAATTGGCACACTGCTTCCACATACATACATGCATTTTTTTGTTCTATTCAATTATGTTGTAATAAAGAGATGCTATGTCGTTAAACTGTACTTTACCATAATAAAACAATACTATGCAGGTAAAAAAGTTTTCTCACAAAGCTGACATATTATGCCATGAAAATATTCACACATTATGCATATTCATGTTATTCACACAATTGAAAGAAAAAAATTATTAAATTCGTGACATGACAACATTGGCCTATTTCCTATGCAATATATAAAATATATATTTAAAAAAAAAAAAACGGATACATAGACAAATATATTTTATATGCCATATAAAACTATTGGCATGGTGAATGTGTTTGGCAAGAGCCATGGCCCAGACAGAATCT
OTHER m477 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous flrm477/m477 (AB/TU) flr ♀+/- ♂+/-
flrm477/m477 flr ♀+/- ♂+/-
Heterozygous flrm477/+ flr ♀+/- ♂+/-
Complex kif3asa1617 ; flrm477 flr, kif3a
Unknown flrm477 (AB) flr Unknown

CITATIONS  (12)