ZFIN ID: ZDB-ALT-980203-405
Genomic Feature: m86
Synonyms:
Affected Genomic Regions: lamc1
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Driever Lab
Location: Chr 2: 35939841 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Tyr>Stop at position 131 (1)
FLANKING SEQUENCE (GENOMIC)
CACTGAAAGCATATGTTCTGTTTTGAGGAGGTTTTTTGGTATTGGACTTTGAAGGAGCCACCCTGTTGCTGTGAAAGGATGGAGGATGAGGAAGCTCTCTAATCTAAAACTTCTTTGTTTGTATTCTGATGATTAATAGTGGTCTCAGAGGATTGAAACAACATGTGGGCAAGTAATAATAACAACAGAATTTTCTTTTTTGGGTGAACTAACACTTTAAGTTCAAACTAAGCTGCATTATTTTCCATTTGCACTGCTTTTGGTAGATTGAGTTAGTCTTTCTGTAGCAAATGATACTATTTATTAATAGAGGAGGTCGAAATTTCCACTTTCTGTGCTTTTATGAGATTATGTGCTTCATAAATCTAAATGGTCCATCTAGTTCAGCTATTTATGGTGTAAAATTGTCAGGTTTTTGATATATTTTGTGAAACACAATGAATGAAGATAACTCATATCACCTTCTTTCATCTTCTAGGCAAATCTTTCGACATCACCTA
T/A
GTGCGTTTGAAGTTCCACACCAGCCGTCCTGAGAGTTTTGCCATCTACAAGCGCTCCAGTGAAGACGGGCCTTGGACCCCCTACCAATACTACAGTGGCTCCTGTGAAAAAACCTACAGCAAAAACAACCGTGGCTTCATCCGCACAGGCGAGGACGAGCAGCAGGCTCTGTGTACAGATGAGTTTAGCGACATCTCGCCACTCTATGGAGGAAACGTGGCTTTCTCTACGCTCGAGGGCCGACCCAGTGCATATAACTTCGACAACAGCCCTGTACTGCAGGTCAGAGCTTTTCTATCTCTCTGTCTTTCTTTGTGATCTCTCCTTTGATCACTCACTTTCACTTAACGTGATTTAAACTCACTCATGAAGTCAAAAGTGATTCCCATCATTTACTGTTTCAAACAAATTTACTGGTGGGAATCAAAATTGCACTCTCCAGATGTGTGGTTGTGCAGTAATGCGTGATTGCAGCCAACTTACTTTTCCAAGACTTCTTT
(1)
OTHER m86 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous lamc1m86/m86 lamc1 ♀+/- ♂+/-
lamc1m86/m86 (AB) lamc1 ♀+/- ♂+/-

CITATIONS  (15)