ZFIN ID: ZDB-ALT-191213-1
Genomic Feature: uu1931
Synonyms:
Affected Genomic Regions: taf1 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR2-taf1
Lab Of Origin: Uppsala University Zebrafish Facility, Regional SciLifeLab Facility
Location: Chr 5: 36586796 - 36586803 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 10 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
CCTCCGGGACACCAAGCATGTCATACCAAAGCTGTGCTGGACCATAACGCCACTCAGCCACCTTTGGCCTCATCTCAGACACTTTATCACCTTCACCAGACACCTGCATGAACTTAGACTCCACCGGAGCCATCATGGTGATCTACAGAAAACAAGACACACAGAAACAGAGTGTTTTCTTTCTGACACCATCATTTTTTAGGAAGCGTCTAAGTCAGAGGTGTCCAAACTGGGCACTGGAGGGCCGGTGTCCTGCAGATTTTTGCTCCAACTTGCCTCAACACACCTGCAAGGATGTTTCTAGAAAGCCTAGTAAGAGCTTGATTAGCTAGCCCAGGTGTGTCTGATTGGGGTTGGAACTAAACTTTGCAGGACACCGGCCCTCCAGGACCGAGCTTGGACATGCCTGGTCTAAGTGGACATAAAATGCTGACTCAGTTAGGATTACCTCATCATCAGACAGACACTGCTCTGGGGGTGGAGGCGGTGCATACTCATAG
TCCCACCC/-
TGATTTTTTCTTAGCCCCTGGTTCAGATGGCAGTGATTCAATGTCACCCGCAGCTGCCATGTCAGACTGTGGCTCTTTCTGCTTTCGTTTTCGCTTCCTGCGCGCACTTCGCCATACAGATGGCATGTTCTTTCCAGGACCAAACAACCGCAAGAACCGCAACACCTGGCAGATTAGAAGGAAACATTAACACTAACAATGAAACACTGCAAACAAACTAATATTTCAACACATATGGGTTTAGCAATCTGACGTAGTAGTATTCAAGCTTTACATTATTTACTAGAGATATTGAGCCAGATTTACTAAACAGTAAAAACAATCTTGACAAATTGTGCAAATGTGATCTACTGACAAATAATAGAGCAAAGGCATAGCAGCTCATTTCCTTAACAGCCAACATAATCTACCAAAAGCAGTACAAATTAATGTAGGGTCACAAGAAGAAGAGCAGATGACAACCAGGGATGAACAAGCAACTAACAACACACCAGTGTTCA
Comment Citation
c.855_862del, p.(Gly296Leufs*2) Gudmundsson et al., 2019
OTHER uu1931 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous taf1uu1931/uu1931 (AB) taf1 ♀+/- ♂+/-

CITATIONS  (1)