ZFIN ID: ZDB-CRISPR-191213-2
CRISPR Name: CRISPR2-taf1
Target: taf1 (1)
Source:
Target Sequence:
5' - GGGCTAAGAAAAAATCAGGGTGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR2-taf1 No data available
GENOMIC FEATURES CREATED WITH CRISPR2-taf1
Genomic Feature Affected Genomic Regions    
uu1931 taf1    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR2-taf1 No data available
PHENOTYPE
Phenotype resulting from CRISPR2-taf1
No data available

Phenotype of all Fish created by or utilizing CRISPR2-taf1
Genome Resources:
CITATIONS (1)