ZFIN ID: ZDB-ALT-191002-2
Genomic Feature: skt2
Synonyms:
Affected Genomic Regions: gipc1 (1)
Type: Insertion (1)
Protocol: embryos treated with CRISPR1-gipc1
Lab Of Origin: Torres-Vazquez Lab
Location: Chr 3: 49134321 - 49134322 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 7 bp inserted (1)
FLANKING SEQUENCE (GENOMIC)
AGGGGGTTTAATAATTTAGATTACCACTGTATATCTAATTTAATATTATATTGTACAGAAATAACATTATCAAAATAAACATAACAGCAATATTTCATATCTTCCCAATATTGTGCAGAAATAATTTTCTCCTGACACACTACAGCAGAAATAACTGACTTTAATCATTTTTAGTTAAAAAAATACTAGTGTTCAAATAATTATGGCCACCACAGTAATGCAAGCAAACATAAACACTCCTTACCTCTGTTGGAGGAATCCCAAAGGCCTCTCCTATCTTAGCATAAAGCTCACGCACGTTACTGAAGCCCTCGATACGTCCTGTGGGGCTGCCGTGAGCCAGCTGTGTGTGGAAGATCAGTCGTGGGCGCAGACTGGTGGGTGGAGGTGGTAAACCCTCATGGGCAGCTCCTTCACCCAAGCCAACCCTGCCACCATCCAGACCATCCAACCCTGAGACGTTCAGTCCAGCCCGGATGGGTTCAGCCTCCTCGTTCTCCA
-/GCGAACT
CCAGCGGAGACGCCTTCTTTCTGCGTCCCAATCCAAGTGGCATTTTTGGGCACTGCTGTCTTTAATGCAAAAGGTGTGTGCACAAGCTTTAATACCGTTCTTTATGTTCCCAAATCGAAGGAGAAATCTCTGCAATTCAACCCATTCAAATCTCCAGATCTATAATGCAAACAGAAACAGACTTTGATGAAAAAGTTTTAAAAATATTTTTTCGATATAAGAAAAAAAATTGAGGTAAAGTTGGTTTTATATTCACACATTCTGCCATTTTAACGGTCTGTATATTGTTTACTACACTAACTTGAATATTCAGCACATATATAATACGCAATAGCACTATTTAATTGACTGTGAACAATGTTGTACTTTGAGAGTCATTGGCTGATAATATAATTTCCCTATTTAGAATTTGCAAATAATACTTTTCTGAAATTATATCAAGGACGTCTGAATGTGTGAATATAAAAACTAAAAACGACATTTGAAAGAGATAATTGCAAC
OTHER skt2 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (1)