ZFIN ID: ZDB-ALT-190716-5
Genomic Feature: ca401
Synonyms:
Affected Genomic Regions: nr3c1 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR2-nr3c1
Lab Of Origin: Vijayan Lab
Location: Chr 14: 23799102 - 23799108 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 7 bp deleted in Exon 2 (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
TGGCTGTGCTGAGGCTGGAAGAAGCTGTGCCATTGAGCGTGTTGCTCCCGGAAACCGCAGCCTTCGAGTCCCTGTCTAAATTTGTCGGCAGCTCTGAAAGGAGAGCATCTTCACCTATGGTGGAGAGAAACGCATCGTCAGCAACGTAGAAGTCTGATGGCGATCCATCCAGCTCAAAGTCCTGCAGGAGGTCCAGAGTGTTGTCACTAAAGAGCTTATGATTGCCAACATCAACATCTTTCCCAATGTGTCCAAAGGAATCTTGGTCAAGGTCCATATCGCCTTTAATCATGGGAGAAAAGTCCTCTGTTTTTAAGGGGAAAAGATTGGGATCGACTCCACCAATCAGGGAATCCATTGAGGGAGAGGGGTTGTTAAGGTCTGCAATGCTGGCCTCCAGACCTGAAAGACTGTCACCCAAAGTGAAGGGGACCAAGGTCTGCTGTTGCAGGGCCCTCTGCTCCTTCCCAAGCAGTTTGAGTTCGGAATCGTCGCCAAAG
ATGGAGG/-
ACACCGAGCTGGTGTGCTCCTCCAGAGTGGGCGAATTGCTCAGGCCATTGGGAATGTCCCCAGAAACTGGCTGCATCATTGGACCGGCTTGAGGAACCATAGATGTAGGGGCCACAGACATGGTGCTTTGTATTCTTCTTGGTAATATCCCCTCAGTTGCTCGTTTGTTGTAATCCAATGTATTTAAACGCTCATCTCGCTTTTTGCCATTCTCCAGTCCTCCTTGATCCATTTTGCATTACTGTGGTAAAACACAACACAACATTGCTGAAAAACACAGTTAACCGAAAGTAATAAACATGATTAAAGAGATAAAGACAGACAAAAATGCAAAAACTAAAACTAACGTTCCTTCCCTCAGGTCATCTACCCGACTCTCTGCAAACTATTTGGAAATTTAAACATATCCTGGCTGTTTTGTTTTTTGATTATTTTCTCTCTGCTAGATTTGAATATTCACACTCACAGCTATAAAATACAGATTTCTACAGATATGTGAT
OTHER ca401 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous nr3c1ca401/ca401 nr3c1 Unknown
nr3c1ca401/ca401 nr3c1 ♀+/- ♂+/-

CITATIONS  (3)