ZFIN ID: ZDB-ALT-190304-4
Genomic Feature: el571
Synonyms:
Affected Genomic Regions: twist1a (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN1-twist1a
Lab Of Origin: Crump Lab
Location: Chr 19: 2230987 - 2230997 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 11 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
AAGTGCAAGTTTTTGAGCCTTTAAAAAGTTTTGCATCGCATACCATGCTGCATCAAACGCGTGCATCCGTGCGTTAGTGGGATGTTGACATGGACCACGCGCCCTCCATTCTCCACACAGAAAACGCGTAGCTGAGTCTCTCGTGCGCCACATAACTGCAGCTGGACATCTTGGAGTCCAGCTCATCGCTCTGCAGGACCTGACAGAGGAAGTCAATGTACCGGGCCGCGAGTTTGAGCGTCTGTATTTTGCTGAGTTTGTCCGAGGGTAAGGTGGGGATGATTTTGCGCAGGGAGGCGAACGCCTCGTTCAGAGACTGAGTCCTCTGACGCTCGCGCACGTTCGCCATGACGCGCTGCGTCTGCAGGTCCTCCAGAGACTGCGGGCTGCTGCTGCTGTTGCTGCACTTCTTGCTCCTCTTCCCGGGCGTGGGACTGTCGGAATCCTCGGCGTTTTTGCGGCTGGCGCGTTTTTTCCTGCTGACGCGCTTCGGTTGTCGC
CTGTCGAGCTC/-
CTCCTCGCTGTTTCCCAGACTGTCCACCGGAGACTCTGGAGAGCTGGAGTCCTCGTGCATCGCCTCTTCCTCAAACATCACCTCTGGAAAAGCTCAGATTGCGGGTCGTGGCTTCCCTGAGTCCGACGGAATGGGGTCAGAGGCTCGGTCCCTCTCAGCGCGTCTCCTCCTGCGTCACGGAGGGCTTTCTCAAACTCGAAGGGGAGTTTACAGGATCTTATAGTCTGGAAGGAGCTAACTTTTTGGGCTGGCCTGCGATTGGACGAGAAGCTGAGTGATGTAAGAAGGGAGAGGCGGGAGGGGACCGCGATCCAAAGGGTTCCGTTATACCAAGAATCAAACGTCTGAGCCAATCAAAGCGCTTCATTTAAAATAAACACAACATAGGCACGCTGTTGATGTTAATATCATTGAAATGCATTAAAATAGAATTGAAAATCCTTTTTTTTGTGTCAAAGAAATAGCCAAATATATCTAAATGAGCATCCATCATCCATTCA
OTHER el571 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Complex twist1ael571/el571 ; tcf12el548/el548 ; twist1bel570/el570 tcf12, twist1a, twist1b
twist1bel570/el570 ; twist1ael571/el571 twist1a, twist1b

CITATIONS  (1)