header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TALEN-190304-2
TALEN Name: TALEN1-twist1a
Target: twist1a (1)
Source:
Target Sequence 1:
5' - TGGACAGTCTGGGAAACAGC - 3'
   
Select Sequence Analysis Tool

Target Sequence 2:
5' - TGACGCGCTTCGGTTGTCGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM TALEN1-twist1a No data available
GENOMIC FEATURES CREATED WITH TALEN1-twist1a
Genomic Feature Affected Genomic Regions    
el571 twist1a    
GENE EXPRESSION
Gene expression in Wild Types + TALEN1-twist1a No data available
PHENOTYPE
Phenotype resulting from TALEN1-twist1a
No data available

Phenotype of all Fish created by or utilizing TALEN1-twist1a
Phenotype Fish Conditions Figures
hyosymplectic cartilage decreased size, abnormal twist1bel570/el570 ; twist1ael571/el571 standard conditions Fig. 2 from Teng et al., 2018
hyosymplectic cartilage morphology, abnormal twist1bel570/el570 ; twist1ael571/el571 standard conditions Fig. 2 from Teng et al., 2018
pharyngeal arch ectomesenchyme sox10 expression increased amount, abnormal twist1bel570/el570 ; twist1ael571/el571 standard conditions Fig. 2 from Teng et al., 2018
pharyngeal arch ectomesenchyme sox10 expression spatial pattern, abnormal twist1bel570/el570 ; twist1ael571/el571 standard conditions Fig. 2 from Teng et al., 2018
palatoquadrate cartilage decreased size, abnormal twist1bel570/el570 ; twist1ael571/el571 standard conditions Fig. 2 from Teng et al., 2018
palatoquadrate cartilage morphology, abnormal twist1bel570/el570 ; twist1ael571/el571 standard conditions Fig. 2 from Teng et al., 2018
pharyngeal arch ectomesenchyme sox10 expression increased amount, abnormal twist1ael571/el571 ; tcf12el548/el548 ; twist1bel570/el570 standard conditions Fig. 2 from Teng et al., 2018
palatoquadrate cartilage morphology, ameliorated twist1ael571/el571 ; tcf12el548/el548 ; twist1bel570/el570 standard conditions Fig. 2 from Teng et al., 2018
hyosymplectic cartilage morphology, ameliorated twist1ael571/el571 ; tcf12el548/el548 ; twist1bel570/el570 standard conditions Fig. 2 from Teng et al., 2018
pharyngeal arch ectomesenchyme sox10 expression spatial pattern, abnormal twist1ael571/el571 ; tcf12el548/el548 ; twist1bel570/el570 standard conditions Fig. 2 from Teng et al., 2018
Genome Resources:
CITATIONS (1)