header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-190123-644
Genomic Feature: sa45027
Synonyms:
Affected Genomic Regions: col22a1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Unmapped
Sequence:
Current Sources:
MUTATION DETAILSNo data available
FLANKING SEQUENCE
GGAAGCAGGGAGCCCAGGATTACCAGGCTTCCCAGGTCCAAAAGGGCCAT
C/A
GGTGAGTTGAGACGTTGGATCGGTTCTGATAGATTTTTTTTTTTGTTCTT
(1)
OTHER sa45027 PAGES
ZMP:sa45027 (1)
GENOTYPESNo data available

CITATIONS  (1)