ZFIN ID: ZDB-ALT-190123-619
Genomic Feature: sa44999
Synonyms:
Affected Genomic Regions: uba1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 23: 20650526 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILSNo data available
FLANKING SEQUENCE
AAGAACCGTGCTGATGTCAGTCAGCCTCGACTGGCAGAACTGAACAGTTA
T/A
GTGCCTGTAACCTCCTACACTGGCACCCTCACCAATGAATACCTGACCAA
(1)
OTHER sa44999 PAGES
ZMP:sa44999 (1)
GENOTYPESNo data available

CITATIONS  (1)