ZFIN ID: ZDB-ALT-190123-560
Genomic Feature: sa44936
Synonyms:
Affected Genomic Regions: kita (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 20: 22346152 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILSNo data available
FLANKING SEQUENCE
GCTTCTCCTACCAAGTAGCCAAAGGGATGGATTTTCTAGCATCAAAAAAC
G/A
TAAGTGTTTCTTTAGTGAATGTTTGGGAGGAGCCTAATCTTTCCTGTCAA
(1)
OTHER sa44936 PAGES
ZMP:sa44936 (1)
GENOTYPESNo data available

CITATIONS  (1)