header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-190123-477
Genomic Feature: sa44846
Synonyms:
Affected Genomic Regions: myh14 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 16: 16928370 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS No data available
FLANKING SEQUENCE
AAATCCCTGATGTGAACATTTTGATGTGTTCCTGTGTGTTTTTTAAGACT
C/T
AGATGAAGGAGCTTATTCGTGAGCTTGACGAAACCAAGTTGGCTCGAGAT
(1)
OTHER sa44846 PAGES
ZMP:sa44846 (1)
GENOTYPES No data available

CITATIONS  (1)